FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636850_at:

>probe:Drosophila_2:1636850_at:177:445; Interrogation_Position=199; Antisense; GATGAGTTGTCGCAGTACCGCAGCC
>probe:Drosophila_2:1636850_at:592:297; Interrogation_Position=217; Antisense; CGCAGCCAAGTCGTCCTGGTAAAGA
>probe:Drosophila_2:1636850_at:673:169; Interrogation_Position=283; Antisense; AAAGGGCTTGCCAATGTCTCTGATA
>probe:Drosophila_2:1636850_at:55:327; Interrogation_Position=310; Antisense; GCGATTCAATGTGTCCAAGCAATGT
>probe:Drosophila_2:1636850_at:254:357; Interrogation_Position=351; Antisense; GCAACTGTAAAGCTTCCTGGGTCTG
>probe:Drosophila_2:1636850_at:285:305; Interrogation_Position=366; Antisense; CCTGGGTCTGGTTGGATACTTTCGA
>probe:Drosophila_2:1636850_at:242:691; Interrogation_Position=395; Antisense; TTACCCAGTACCTTTCAGTCATTTA
>probe:Drosophila_2:1636850_at:101:463; Interrogation_Position=429; Antisense; GATTACACAGAAACCTCGATCTCGA
>probe:Drosophila_2:1636850_at:468:427; Interrogation_Position=458; Antisense; GAGATCCTGTTAGTCGTAGAAGCAT
>probe:Drosophila_2:1636850_at:187:377; Interrogation_Position=476; Antisense; GAAGCATTCCGAAAGTTCCGAGTAC
>probe:Drosophila_2:1636850_at:649:615; Interrogation_Position=513; Antisense; TGCACAACCCAGATAGACACGGCTA
>probe:Drosophila_2:1636850_at:635:105; Interrogation_Position=527; Antisense; AGACACGGCTAGTGATCCTGATAAA
>probe:Drosophila_2:1636850_at:486:495; Interrogation_Position=58; Antisense; GTCTCGGTGTAATATCTTTCGGTTA
>probe:Drosophila_2:1636850_at:348:673; Interrogation_Position=586; Antisense; TAGCGAACTTTGTATACCACTTTTA

Paste this into a BLAST search page for me
GATGAGTTGTCGCAGTACCGCAGCCCGCAGCCAAGTCGTCCTGGTAAAGAAAAGGGCTTGCCAATGTCTCTGATAGCGATTCAATGTGTCCAAGCAATGTGCAACTGTAAAGCTTCCTGGGTCTGCCTGGGTCTGGTTGGATACTTTCGATTACCCAGTACCTTTCAGTCATTTAGATTACACAGAAACCTCGATCTCGAGAGATCCTGTTAGTCGTAGAAGCATGAAGCATTCCGAAAGTTCCGAGTACTGCACAACCCAGATAGACACGGCTAAGACACGGCTAGTGATCCTGATAAAGTCTCGGTGTAATATCTTTCGGTTATAGCGAACTTTGTATACCACTTTTA

Full Affymetrix probeset data:

Annotations for 1636850_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720