FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636851_at:

>probe:Drosophila_2:1636851_at:447:587; Interrogation_Position=395; Antisense; TGGACGCCATGCAATCCCTTGGGAT
>probe:Drosophila_2:1636851_at:152:349; Interrogation_Position=425; Antisense; GCAGGACCAGACTCATAGACGCCAG
>probe:Drosophila_2:1636851_at:575:1; Interrogation_Position=439; Antisense; ATAGACGCCAGTCCCCAGAGAAAGG
>probe:Drosophila_2:1636851_at:185:427; Interrogation_Position=471; Antisense; TACTTCGGTACTGTTCCTGGGTAAG
>probe:Drosophila_2:1636851_at:701:459; Interrogation_Position=496; Antisense; GATTCAAGGACCACCAAGATGCCCA
>probe:Drosophila_2:1636851_at:510:205; Interrogation_Position=529; Antisense; AAGCCCTCAAGCGAAAAGCCTGCAA
>probe:Drosophila_2:1636851_at:663:191; Interrogation_Position=640; Antisense; AACTTCTTCTGCAATCTCGGCGTAA
>probe:Drosophila_2:1636851_at:408:285; Interrogation_Position=660; Antisense; CGTAAAGATGCAGCCACCGGTGACT
>probe:Drosophila_2:1636851_at:181:551; Interrogation_Position=779; Antisense; GGAGACCAGTGAGAACCCAGCCATC
>probe:Drosophila_2:1636851_at:712:533; Interrogation_Position=805; Antisense; GGTCTGTCATCCCTAGTCGGTAAAG
>probe:Drosophila_2:1636851_at:55:485; Interrogation_Position=836; Antisense; GTATCGGTGCGTTCGCCAATGATGT
>probe:Drosophila_2:1636851_at:99:271; Interrogation_Position=888; Antisense; CATCATCGACTTTATCTCTACCAAA
>probe:Drosophila_2:1636851_at:710:263; Interrogation_Position=919; Antisense; CAGAATATGTCTGCCGCTTCGAAAT
>probe:Drosophila_2:1636851_at:151:711; Interrogation_Position=936; Antisense; TTCGAAATGGAAGCCGCACTCGCGG

Paste this into a BLAST search page for me
TGGACGCCATGCAATCCCTTGGGATGCAGGACCAGACTCATAGACGCCAGATAGACGCCAGTCCCCAGAGAAAGGTACTTCGGTACTGTTCCTGGGTAAGGATTCAAGGACCACCAAGATGCCCAAAGCCCTCAAGCGAAAAGCCTGCAAAACTTCTTCTGCAATCTCGGCGTAACGTAAAGATGCAGCCACCGGTGACTGGAGACCAGTGAGAACCCAGCCATCGGTCTGTCATCCCTAGTCGGTAAAGGTATCGGTGCGTTCGCCAATGATGTCATCATCGACTTTATCTCTACCAAACAGAATATGTCTGCCGCTTCGAAATTTCGAAATGGAAGCCGCACTCGCGG

Full Affymetrix probeset data:

Annotations for 1636851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720