Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636852_at:

>probe:Drosophila_2:1636852_at:81:213; Interrogation_Position=2032; Antisense; AAGACACGCCGTGACTTGATCGACG
>probe:Drosophila_2:1636852_at:209:727; Interrogation_Position=2047; Antisense; TTGATCGACGCAGCCTGGAATCGCT
>probe:Drosophila_2:1636852_at:565:563; Interrogation_Position=2063; Antisense; GGAATCGCTACGCTTTCAACGATGA
>probe:Drosophila_2:1636852_at:176:437; Interrogation_Position=2083; Antisense; GATGAGAACGTTCCCGTTTGGTTCA
>probe:Drosophila_2:1636852_at:632:713; Interrogation_Position=2093; Antisense; TTCCCGTTTGGTTCAAGCTCGATGA
>probe:Drosophila_2:1636852_at:37:421; Interrogation_Position=2122; Antisense; GAGCATATGACCAAGCCAACACCGG
>probe:Drosophila_2:1636852_at:154:627; Interrogation_Position=2147; Antisense; TGCCGAAGGAGCTGACCGCCGAGTA
>probe:Drosophila_2:1636852_at:269:77; Interrogation_Position=2186; Antisense; AGGAGGTGAACGTGCGTCCGATCAA
>probe:Drosophila_2:1636852_at:308:227; Interrogation_Position=2227; Antisense; AAGGCGCGCAAGCATCGTCGTGCCA
>probe:Drosophila_2:1636852_at:366:501; Interrogation_Position=2243; Antisense; GTCGTGCCACGAAACGCTTGGCCAA
>probe:Drosophila_2:1636852_at:725:121; Interrogation_Position=2302; Antisense; AGCGATGCCACCAACCACGAGAAGT
>probe:Drosophila_2:1636852_at:438:109; Interrogation_Position=2396; Antisense; AGAAGCAGACAGCAGCTCGACGCGC
>probe:Drosophila_2:1636852_at:330:131; Interrogation_Position=2421; Antisense; ACGTCGTCCAGCTGGCGTCAAGGGT
>probe:Drosophila_2:1636852_at:321:31; Interrogation_Position=2450; Antisense; ATAAGGTCGTCGATCCGCGCGAGAA

Paste this into a BLAST search page for me
AAGACACGCCGTGACTTGATCGACGTTGATCGACGCAGCCTGGAATCGCTGGAATCGCTACGCTTTCAACGATGAGATGAGAACGTTCCCGTTTGGTTCATTCCCGTTTGGTTCAAGCTCGATGAGAGCATATGACCAAGCCAACACCGGTGCCGAAGGAGCTGACCGCCGAGTAAGGAGGTGAACGTGCGTCCGATCAAAAGGCGCGCAAGCATCGTCGTGCCAGTCGTGCCACGAAACGCTTGGCCAAAGCGATGCCACCAACCACGAGAAGTAGAAGCAGACAGCAGCTCGACGCGCACGTCGTCCAGCTGGCGTCAAGGGTATAAGGTCGTCGATCCGCGCGAGAA

Full Affymetrix probeset data:

Annotations for 1636852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime