FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636853_at:

>probe:Drosophila_2:1636853_at:454:267; Interrogation_Position=1289; Antisense; CAGGTGCGCCAGGAGCACCAGGATC
>probe:Drosophila_2:1636853_at:355:75; Interrogation_Position=1299; Antisense; AGGAGCACCAGGATCCCCAGGTGGT
>probe:Drosophila_2:1636853_at:669:79; Interrogation_Position=1380; Antisense; AGGTGCCCCAGGAGCTCCAGGATCG
>probe:Drosophila_2:1636853_at:246:115; Interrogation_Position=1482; Antisense; AGCTCCTGGCTCTCCCGGAGGAGGA
>probe:Drosophila_2:1636853_at:182:37; Interrogation_Position=1590; Antisense; ATCTCCAGGCGGTCCAGGTTATGGA
>probe:Drosophila_2:1636853_at:207:71; Interrogation_Position=1653; Antisense; AGGCGGACCAGGATTGCCCGGCAAT
>probe:Drosophila_2:1636853_at:691:7; Interrogation_Position=1665; Antisense; ATTGCCCGGCAATCAGTATGTTCCA
>probe:Drosophila_2:1636853_at:316:565; Interrogation_Position=1672; Antisense; GGCAATCAGTATGTTCCACCAGCGG
>probe:Drosophila_2:1636853_at:345:647; Interrogation_Position=1677; Antisense; TCAGTATGTTCCACCAGCGGCTGGT
>probe:Drosophila_2:1636853_at:628:281; Interrogation_Position=1716; Antisense; CTCGCCAGGCAGACCAGGATCGGGA
>probe:Drosophila_2:1636853_at:705:75; Interrogation_Position=1740; Antisense; AGGAGTTCCCGGCACAGGATCACAG
>probe:Drosophila_2:1636853_at:212:79; Interrogation_Position=1755; Antisense; AGGATCACAGTACATTCCACCTGCT
>probe:Drosophila_2:1636853_at:197:561; Interrogation_Position=1804; Antisense; GGAAACGGAGAGTTCAATCCTCAGA
>probe:Drosophila_2:1636853_at:614:711; Interrogation_Position=1816; Antisense; TTCAATCCTCAGACGGGCTATAGCT

Paste this into a BLAST search page for me
CAGGTGCGCCAGGAGCACCAGGATCAGGAGCACCAGGATCCCCAGGTGGTAGGTGCCCCAGGAGCTCCAGGATCGAGCTCCTGGCTCTCCCGGAGGAGGAATCTCCAGGCGGTCCAGGTTATGGAAGGCGGACCAGGATTGCCCGGCAATATTGCCCGGCAATCAGTATGTTCCAGGCAATCAGTATGTTCCACCAGCGGTCAGTATGTTCCACCAGCGGCTGGTCTCGCCAGGCAGACCAGGATCGGGAAGGAGTTCCCGGCACAGGATCACAGAGGATCACAGTACATTCCACCTGCTGGAAACGGAGAGTTCAATCCTCAGATTCAATCCTCAGACGGGCTATAGCT

Full Affymetrix probeset data:

Annotations for 1636853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720