FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636855_at:

>probe:Drosophila_2:1636855_at:301:585; Interrogation_Position=204; Antisense; TGGAATGTCATACCTGAACTCGTAA
>probe:Drosophila_2:1636855_at:610:19; Interrogation_Position=319; Antisense; ATTTGCTGATAAATTGATTTCCCTA
>probe:Drosophila_2:1636855_at:608:273; Interrogation_Position=526; Antisense; CATTAATTCCATTTGCTTCTCTTGA
>probe:Drosophila_2:1636855_at:553:343; Interrogation_Position=540; Antisense; GCTTCTCTTGAATCGAGCGCAAAGA
>probe:Drosophila_2:1636855_at:312:231; Interrogation_Position=568; Antisense; AATGTTCTCATTAAGCGTCTGCAGG
>probe:Drosophila_2:1636855_at:149:77; Interrogation_Position=590; Antisense; AGGATGGCTTCAATGCTGCTGCTAG
>probe:Drosophila_2:1636855_at:343:619; Interrogation_Position=609; Antisense; TGCTAGCATCCGTCGAGCGCTGGAG
>probe:Drosophila_2:1636855_at:592:415; Interrogation_Position=623; Antisense; GAGCGCTGGAGTGTACCCCTAGACG
>probe:Drosophila_2:1636855_at:96:525; Interrogation_Position=680; Antisense; GGGCTTCCATCATAGGGCTGTTGCT
>probe:Drosophila_2:1636855_at:351:603; Interrogation_Position=704; Antisense; TGTTGCTTCTGTTGCTGGTGCGTCA
>probe:Drosophila_2:1636855_at:523:535; Interrogation_Position=720; Antisense; GGTGCGTCAGGCTCATTGGTTGCTT
>probe:Drosophila_2:1636855_at:489:571; Interrogation_Position=729; Antisense; GGCTCATTGGTTGCTTGTGGTGAAT
>probe:Drosophila_2:1636855_at:649:729; Interrogation_Position=743; Antisense; TTGTGGTGAATGGACCCTCTAGCCA
>probe:Drosophila_2:1636855_at:259:301; Interrogation_Position=757; Antisense; CCCTCTAGCCACATCTGCATAAGAT

Paste this into a BLAST search page for me
TGGAATGTCATACCTGAACTCGTAAATTTGCTGATAAATTGATTTCCCTACATTAATTCCATTTGCTTCTCTTGAGCTTCTCTTGAATCGAGCGCAAAGAAATGTTCTCATTAAGCGTCTGCAGGAGGATGGCTTCAATGCTGCTGCTAGTGCTAGCATCCGTCGAGCGCTGGAGGAGCGCTGGAGTGTACCCCTAGACGGGGCTTCCATCATAGGGCTGTTGCTTGTTGCTTCTGTTGCTGGTGCGTCAGGTGCGTCAGGCTCATTGGTTGCTTGGCTCATTGGTTGCTTGTGGTGAATTTGTGGTGAATGGACCCTCTAGCCACCCTCTAGCCACATCTGCATAAGAT

Full Affymetrix probeset data:

Annotations for 1636855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720