FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636856_at:

>probe:Drosophila_2:1636856_at:497:279; Interrogation_Position=1005; Antisense; CTCTAGGTCTAGTTGCTTCAGATGC
>probe:Drosophila_2:1636856_at:459:65; Interrogation_Position=1042; Antisense; ATGGTATGTCTGCAGTTACTCCTTT
>probe:Drosophila_2:1636856_at:248:351; Interrogation_Position=1053; Antisense; GCAGTTACTCCTTTGCAATGCTTAT
>probe:Drosophila_2:1636856_at:228:233; Interrogation_Position=1069; Antisense; AATGCTTATCTACGTGTGTCGCAAG
>probe:Drosophila_2:1636856_at:363:705; Interrogation_Position=1187; Antisense; TTAACGCTCGTACAGATTCTCCTTG
>probe:Drosophila_2:1636856_at:191:515; Interrogation_Position=1221; Antisense; GTGTTTGTCCACGAGTCGAGTCGAG
>probe:Drosophila_2:1636856_at:223:407; Interrogation_Position=730; Antisense; GGCGGGTAATCATCTTAGGGACTGA
>probe:Drosophila_2:1636856_at:468:425; Interrogation_Position=753; Antisense; GAGAGACAGGCTTGATTTCCAAATA
>probe:Drosophila_2:1636856_at:725:245; Interrogation_Position=791; Antisense; AATTGATTTCCATCCTGGTTTTCGA
>probe:Drosophila_2:1636856_at:125:461; Interrogation_Position=814; Antisense; GATTTTCGCTTATTACTTATGTACA
>probe:Drosophila_2:1636856_at:317:729; Interrogation_Position=841; Antisense; TTGGCTTGCATAGAGCTCTTTACAA
>probe:Drosophila_2:1636856_at:115:335; Interrogation_Position=855; Antisense; GCTCTTTACAAGTTGGGCTACTACC
>probe:Drosophila_2:1636856_at:153:525; Interrogation_Position=869; Antisense; GGGCTACTACCATTGCATTGATTTT
>probe:Drosophila_2:1636856_at:277:687; Interrogation_Position=992; Antisense; TATATGCGCAATACTCTAGGTCTAG

Paste this into a BLAST search page for me
CTCTAGGTCTAGTTGCTTCAGATGCATGGTATGTCTGCAGTTACTCCTTTGCAGTTACTCCTTTGCAATGCTTATAATGCTTATCTACGTGTGTCGCAAGTTAACGCTCGTACAGATTCTCCTTGGTGTTTGTCCACGAGTCGAGTCGAGGGCGGGTAATCATCTTAGGGACTGAGAGAGACAGGCTTGATTTCCAAATAAATTGATTTCCATCCTGGTTTTCGAGATTTTCGCTTATTACTTATGTACATTGGCTTGCATAGAGCTCTTTACAAGCTCTTTACAAGTTGGGCTACTACCGGGCTACTACCATTGCATTGATTTTTATATGCGCAATACTCTAGGTCTAG

Full Affymetrix probeset data:

Annotations for 1636856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720