FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636857_at:

>probe:Drosophila_2:1636857_at:245:553; Interrogation_Position=1013; Antisense; GGAGCACACACGCTAAGAGCAAGCT
>probe:Drosophila_2:1636857_at:697:611; Interrogation_Position=533; Antisense; TGACACAGGTCCTCGCCAAAGGAAG
>probe:Drosophila_2:1636857_at:293:373; Interrogation_Position=554; Antisense; GAAGTGACAACTCGGTGACGCCAGA
>probe:Drosophila_2:1636857_at:343:101; Interrogation_Position=576; Antisense; AGAGTTTGCCCAACACTTGCTTCAC
>probe:Drosophila_2:1636857_at:238:647; Interrogation_Position=597; Antisense; TCACCGGCAGGTGTCGAAGTCGCAA
>probe:Drosophila_2:1636857_at:478:373; Interrogation_Position=612; Antisense; GAAGTCGCAACTCTATCCAGACAGA
>probe:Drosophila_2:1636857_at:189:105; Interrogation_Position=630; Antisense; AGACAGATTCTTCTTCTCCAGAGAT
>probe:Drosophila_2:1636857_at:561:285; Interrogation_Position=724; Antisense; CGGAGAATACCCTGTTTGATCATTA
>probe:Drosophila_2:1636857_at:437:225; Interrogation_Position=787; Antisense; AAGGCGGTTGCCATCTTACGTCAAA
>probe:Drosophila_2:1636857_at:178:707; Interrogation_Position=802; Antisense; TTACGTCAAAACAATCCGCACTTCG
>probe:Drosophila_2:1636857_at:488:531; Interrogation_Position=839; Antisense; TGGAGGGAGGTACCCACCACGTTCA
>probe:Drosophila_2:1636857_at:569:271; Interrogation_Position=862; Antisense; CATCTTCATGCTGCCGAGGAGTGTG
>probe:Drosophila_2:1636857_at:578:433; Interrogation_Position=880; Antisense; GAGTGTGCCCGATACATAGTGCCCT
>probe:Drosophila_2:1636857_at:482:649; Interrogation_Position=932; Antisense; TCACTTCTTGGTCCTTGAGTGGCAA

Paste this into a BLAST search page for me
GGAGCACACACGCTAAGAGCAAGCTTGACACAGGTCCTCGCCAAAGGAAGGAAGTGACAACTCGGTGACGCCAGAAGAGTTTGCCCAACACTTGCTTCACTCACCGGCAGGTGTCGAAGTCGCAAGAAGTCGCAACTCTATCCAGACAGAAGACAGATTCTTCTTCTCCAGAGATCGGAGAATACCCTGTTTGATCATTAAAGGCGGTTGCCATCTTACGTCAAATTACGTCAAAACAATCCGCACTTCGTGGAGGGAGGTACCCACCACGTTCACATCTTCATGCTGCCGAGGAGTGTGGAGTGTGCCCGATACATAGTGCCCTTCACTTCTTGGTCCTTGAGTGGCAA

Full Affymetrix probeset data:

Annotations for 1636857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720