FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636858_at:

>probe:Drosophila_2:1636858_at:574:1; Interrogation_Position=1013; Antisense; ATTGACGCCGAATCAGGGAAAGTAT
>probe:Drosophila_2:1636858_at:483:361; Interrogation_Position=1282; Antisense; GCAAGTTCCAGGTGCGGATGTAGAC
>probe:Drosophila_2:1636858_at:278:631; Interrogation_Position=1317; Antisense; TCCGGATTCCAATTCCAGCTTTAAT
>probe:Drosophila_2:1636858_at:599:337; Interrogation_Position=1347; Antisense; GCTAACGTTAAGTGTATTCCGCTTG
>probe:Drosophila_2:1636858_at:592:697; Interrogation_Position=1382; Antisense; TTTCATTTGATGTTCTAGCCCTCGT
>probe:Drosophila_2:1636858_at:680:643; Interrogation_Position=1408; Antisense; TCTCTCCCTGTGTATCTCATTTATG
>probe:Drosophila_2:1636858_at:328:707; Interrogation_Position=1458; Antisense; TTAACTTCAAGTGTAGTCGCCTTGT
>probe:Drosophila_2:1636858_at:271:149; Interrogation_Position=886; Antisense; ACTTTTCGATCAAAACGGGTGAGCA
>probe:Drosophila_2:1636858_at:552:499; Interrogation_Position=916; Antisense; GTCTGGACCTCACGATTGGCCCGAG
>probe:Drosophila_2:1636858_at:394:465; Interrogation_Position=929; Antisense; GATTGGCCCGAGGAACACCCTTGGT
>probe:Drosophila_2:1636858_at:427:275; Interrogation_Position=948; Antisense; CTTGGTCGCACCGTTGACAAGGTGA
>probe:Drosophila_2:1636858_at:12:615; Interrogation_Position=970; Antisense; TGAAGCTGGAGCTGACCATGCCGCG
>probe:Drosophila_2:1636858_at:171:129; Interrogation_Position=984; Antisense; ACCATGCCGCGGTGTGTGCTTAATT
>probe:Drosophila_2:1636858_at:451:509; Interrogation_Position=999; Antisense; GTGCTTAATTGCCTATTGACGCCGA

Paste this into a BLAST search page for me
ATTGACGCCGAATCAGGGAAAGTATGCAAGTTCCAGGTGCGGATGTAGACTCCGGATTCCAATTCCAGCTTTAATGCTAACGTTAAGTGTATTCCGCTTGTTTCATTTGATGTTCTAGCCCTCGTTCTCTCCCTGTGTATCTCATTTATGTTAACTTCAAGTGTAGTCGCCTTGTACTTTTCGATCAAAACGGGTGAGCAGTCTGGACCTCACGATTGGCCCGAGGATTGGCCCGAGGAACACCCTTGGTCTTGGTCGCACCGTTGACAAGGTGATGAAGCTGGAGCTGACCATGCCGCGACCATGCCGCGGTGTGTGCTTAATTGTGCTTAATTGCCTATTGACGCCGA

Full Affymetrix probeset data:

Annotations for 1636858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720