FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636861_at:

>probe:Drosophila_2:1636861_at:201:537; Interrogation_Position=1004; Antisense; GGTCGGCCAACCAATGTGATGAATG
>probe:Drosophila_2:1636861_at:217:687; Interrogation_Position=1082; Antisense; TATTACCGATTACCGAACTGTTCTC
>probe:Drosophila_2:1636861_at:192:383; Interrogation_Position=1096; Antisense; GAACTGTTCTCTCCATACGTTTAGT
>probe:Drosophila_2:1636861_at:33:479; Interrogation_Position=1114; Antisense; GTTTAGTTTCCTTCTACGCCGATTG
>probe:Drosophila_2:1636861_at:602:463; Interrogation_Position=1134; Antisense; GATTGCCGTGGCCTTCGAGATCCCA
>probe:Drosophila_2:1636861_at:603:143; Interrogation_Position=1164; Antisense; ACTCCTGCATTTGATCGGGTTTGGT
>probe:Drosophila_2:1636861_at:696:261; Interrogation_Position=1204; Antisense; CAGCGCATGGCACGCATTTAGTTTA
>probe:Drosophila_2:1636861_at:504:505; Interrogation_Position=1267; Antisense; GTGCAGCCGACCACCGAATGGTTGA
>probe:Drosophila_2:1636861_at:202:371; Interrogation_Position=1282; Antisense; GAATGGTTGATAGCTCCACGAACAG
>probe:Drosophila_2:1636861_at:273:527; Interrogation_Position=767; Antisense; GGAGGACACGCGCTTCCGTTTCTTT
>probe:Drosophila_2:1636861_at:322:315; Interrogation_Position=798; Antisense; GCGCGCTTCTCGAGGAGGTACAGTA
>probe:Drosophila_2:1636861_at:109:449; Interrogation_Position=829; Antisense; GATCCGGCCGGAAATTTGCGCGAAA
>probe:Drosophila_2:1636861_at:223:217; Interrogation_Position=852; Antisense; AAGTTCGCCCGATTTGAGCATCATG
>probe:Drosophila_2:1636861_at:400:419; Interrogation_Position=917; Antisense; GAGCTTCAATGATGCAGACACCTGA

Paste this into a BLAST search page for me
GGTCGGCCAACCAATGTGATGAATGTATTACCGATTACCGAACTGTTCTCGAACTGTTCTCTCCATACGTTTAGTGTTTAGTTTCCTTCTACGCCGATTGGATTGCCGTGGCCTTCGAGATCCCAACTCCTGCATTTGATCGGGTTTGGTCAGCGCATGGCACGCATTTAGTTTAGTGCAGCCGACCACCGAATGGTTGAGAATGGTTGATAGCTCCACGAACAGGGAGGACACGCGCTTCCGTTTCTTTGCGCGCTTCTCGAGGAGGTACAGTAGATCCGGCCGGAAATTTGCGCGAAAAAGTTCGCCCGATTTGAGCATCATGGAGCTTCAATGATGCAGACACCTGA

Full Affymetrix probeset data:

Annotations for 1636861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720