Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636862_at:

>probe:Drosophila_2:1636862_at:658:309; Interrogation_Position=1184; Antisense; CCACGTGGCGGCATTTGTGTTCAAT
>probe:Drosophila_2:1636862_at:88:247; Interrogation_Position=1230; Antisense; AATTGCCGCAGGTGGGCCTACCAGG
>probe:Drosophila_2:1636862_at:730:455; Interrogation_Position=1302; Antisense; GATAGCTTCAAGTACACCTGCACTA
>probe:Drosophila_2:1636862_at:695:329; Interrogation_Position=1348; Antisense; GCGTGGCCGACTTGAGCATGCAGAA
>probe:Drosophila_2:1636862_at:83:107; Interrogation_Position=1369; Antisense; AGAACCTACGTTGCTACTACTGCCA
>probe:Drosophila_2:1636862_at:259:99; Interrogation_Position=1429; Antisense; AGATGTACGATTGGACCCGGTCAGA
>probe:Drosophila_2:1636862_at:436:533; Interrogation_Position=1447; Antisense; GGTCAGATCCGACGATGACACCGTT
>probe:Drosophila_2:1636862_at:722:303; Interrogation_Position=1467; Antisense; CCGTTCAAGTGCTTTATTTGGGACA
>probe:Drosophila_2:1636862_at:347:153; Interrogation_Position=1489; Antisense; ACAGGTACTTGCAGCTGGGCGAGCA
>probe:Drosophila_2:1636862_at:474:145; Interrogation_Position=1528; Antisense; ACTCCACGAATATGGCGTTGCTCAA
>probe:Drosophila_2:1636862_at:357:123; Interrogation_Position=1595; Antisense; AGCGACTTTGCTGCTGGCATAGAAT
>probe:Drosophila_2:1636862_at:513:485; Interrogation_Position=1649; Antisense; GTGACTTAACCACAAAATCCCATTA
>probe:Drosophila_2:1636862_at:508:245; Interrogation_Position=1713; Antisense; AATTATTGTTTCTTTGTTTCTCTTG
>probe:Drosophila_2:1636862_at:471:479; Interrogation_Position=1728; Antisense; GTTTCTCTTGTTTTCTGTTACCAGT

Paste this into a BLAST search page for me
CCACGTGGCGGCATTTGTGTTCAATAATTGCCGCAGGTGGGCCTACCAGGGATAGCTTCAAGTACACCTGCACTAGCGTGGCCGACTTGAGCATGCAGAAAGAACCTACGTTGCTACTACTGCCAAGATGTACGATTGGACCCGGTCAGAGGTCAGATCCGACGATGACACCGTTCCGTTCAAGTGCTTTATTTGGGACAACAGGTACTTGCAGCTGGGCGAGCAACTCCACGAATATGGCGTTGCTCAAAGCGACTTTGCTGCTGGCATAGAATGTGACTTAACCACAAAATCCCATTAAATTATTGTTTCTTTGTTTCTCTTGGTTTCTCTTGTTTTCTGTTACCAGT

Full Affymetrix probeset data:

Annotations for 1636862_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime