Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636864_at:

>probe:Drosophila_2:1636864_at:498:157; Interrogation_Position=2479; Antisense; ACACACCCATCAAAGCTTTTAGAAT
>probe:Drosophila_2:1636864_at:391:159; Interrogation_Position=2540; Antisense; ACAAAATTCTGTCTAGCTGCTATGA
>probe:Drosophila_2:1636864_at:444:619; Interrogation_Position=2557; Antisense; TGCTATGAGAAATTGTTGTCCGACG
>probe:Drosophila_2:1636864_at:684:423; Interrogation_Position=2563; Antisense; GAGAAATTGTTGTCCGACGGTGAGA
>probe:Drosophila_2:1636864_at:309:51; Interrogation_Position=2597; Antisense; ATGAGCGATCTTTTTTTCTTTTAGT
>probe:Drosophila_2:1636864_at:675:389; Interrogation_Position=2749; Antisense; GAAACAACAGCAACCGCTCTGTGTA
>probe:Drosophila_2:1636864_at:336:155; Interrogation_Position=2755; Antisense; ACAGCAACCGCTCTGTGTAAGCCAA
>probe:Drosophila_2:1636864_at:405:297; Interrogation_Position=2763; Antisense; CGCTCTGTGTAAGCCAACCACATAA
>probe:Drosophila_2:1636864_at:337:493; Interrogation_Position=2771; Antisense; GTAAGCCAACCACATAAACAATAAC
>probe:Drosophila_2:1636864_at:387:359; Interrogation_Position=2800; Antisense; GCAACAACGGCAAAAACAAGAACTG
>probe:Drosophila_2:1636864_at:157:161; Interrogation_Position=2838; Antisense; AACGGCAGCAACATTAAACAAAACA
>probe:Drosophila_2:1636864_at:730:339; Interrogation_Position=2866; Antisense; GCTAAAAGTTACACATACGCATATT
>probe:Drosophila_2:1636864_at:323:597; Interrogation_Position=2910; Antisense; TGTTACAACAACCATTTACCGAAAG
>probe:Drosophila_2:1636864_at:8:251; Interrogation_Position=3040; Antisense; CAACGTAATTTGAAGCGAGATATGC

Paste this into a BLAST search page for me
ACACACCCATCAAAGCTTTTAGAATACAAAATTCTGTCTAGCTGCTATGATGCTATGAGAAATTGTTGTCCGACGGAGAAATTGTTGTCCGACGGTGAGAATGAGCGATCTTTTTTTCTTTTAGTGAAACAACAGCAACCGCTCTGTGTAACAGCAACCGCTCTGTGTAAGCCAACGCTCTGTGTAAGCCAACCACATAAGTAAGCCAACCACATAAACAATAACGCAACAACGGCAAAAACAAGAACTGAACGGCAGCAACATTAAACAAAACAGCTAAAAGTTACACATACGCATATTTGTTACAACAACCATTTACCGAAAGCAACGTAATTTGAAGCGAGATATGC

Full Affymetrix probeset data:

Annotations for 1636864_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime