FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636865_at:

>probe:Drosophila_2:1636865_at:26:615; Interrogation_Position=227; Antisense; TGAATACGGACAACACGCCATCGGC
>probe:Drosophila_2:1636865_at:120:641; Interrogation_Position=247; Antisense; TCGGCTCGAGCGGTTATTCCAGGCG
>probe:Drosophila_2:1636865_at:466:1; Interrogation_Position=262; Antisense; ATTCCAGGCGAGCAAGTAGTCCCCA
>probe:Drosophila_2:1636865_at:604:217; Interrogation_Position=275; Antisense; AAGTAGTCCCCATTCTCTTGGAGGC
>probe:Drosophila_2:1636865_at:656:439; Interrogation_Position=295; Antisense; GAGGCCATTCTTCCCAGCGTGGATG
>probe:Drosophila_2:1636865_at:543:445; Interrogation_Position=316; Antisense; GATGCAGCGGGCGATCGCTTCGCAA
>probe:Drosophila_2:1636865_at:355:45; Interrogation_Position=329; Antisense; ATCGCTTCGCAAGATCTGTGCAATT
>probe:Drosophila_2:1636865_at:337:613; Interrogation_Position=356; Antisense; TGAAAAACTTGACCCCTGGCTCTGA
>probe:Drosophila_2:1636865_at:544:569; Interrogation_Position=373; Antisense; GGCTCTGAATTGTTTGCCGTCGAGA
>probe:Drosophila_2:1636865_at:59:377; Interrogation_Position=396; Antisense; GAAGAACGAATAGCCGAGCCAAATT
>probe:Drosophila_2:1636865_at:613:561; Interrogation_Position=440; Antisense; GGAACTGGACCGGAATTGATTTGAC
>probe:Drosophila_2:1636865_at:519:433; Interrogation_Position=613; Antisense; GAGGTATTAGTGCTACCCCTAATTA
>probe:Drosophila_2:1636865_at:628:207; Interrogation_Position=663; Antisense; AAGCTCTCAGATTGTTGTTTAACCT
>probe:Drosophila_2:1636865_at:69:635; Interrogation_Position=703; Antisense; TCGTTTTCCGCACTGGTTAAAATAT

Paste this into a BLAST search page for me
TGAATACGGACAACACGCCATCGGCTCGGCTCGAGCGGTTATTCCAGGCGATTCCAGGCGAGCAAGTAGTCCCCAAAGTAGTCCCCATTCTCTTGGAGGCGAGGCCATTCTTCCCAGCGTGGATGGATGCAGCGGGCGATCGCTTCGCAAATCGCTTCGCAAGATCTGTGCAATTTGAAAAACTTGACCCCTGGCTCTGAGGCTCTGAATTGTTTGCCGTCGAGAGAAGAACGAATAGCCGAGCCAAATTGGAACTGGACCGGAATTGATTTGACGAGGTATTAGTGCTACCCCTAATTAAAGCTCTCAGATTGTTGTTTAACCTTCGTTTTCCGCACTGGTTAAAATAT

Full Affymetrix probeset data:

Annotations for 1636865_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720