FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636868_at:

>probe:Drosophila_2:1636868_at:35:451; Interrogation_Position=2019; Antisense; GATACAGAAACCTAAACCGAACAGT
>probe:Drosophila_2:1636868_at:171:599; Interrogation_Position=2079; Antisense; TGTAATTGACTTGGCCACCTAATCC
>probe:Drosophila_2:1636868_at:682:233; Interrogation_Position=2099; Antisense; AATCCAGCTGGCATCTAAGCAATTT
>probe:Drosophila_2:1636868_at:586:15; Interrogation_Position=2120; Antisense; ATTTAATCTCAACGGTTGGCCACGG
>probe:Drosophila_2:1636868_at:16:581; Interrogation_Position=2136; Antisense; TGGCCACGGCCACCAAATTGTCATT
>probe:Drosophila_2:1636868_at:624:247; Interrogation_Position=2151; Antisense; AATTGTCATTTACTTAGCGCGTCCG
>probe:Drosophila_2:1636868_at:113:151; Interrogation_Position=2198; Antisense; ACATTTCCCTGTACATTTGTTACGA
>probe:Drosophila_2:1636868_at:194:19; Interrogation_Position=2228; Antisense; ATTTGTTTACCTTACATCCATGTTT
>probe:Drosophila_2:1636868_at:280:291; Interrogation_Position=2275; Antisense; CGTGTGATTCTTATATAGTTTCCAT
>probe:Drosophila_2:1636868_at:628:89; Interrogation_Position=2291; Antisense; AGTTTCCATTTAGCTTTATATACGA
>probe:Drosophila_2:1636868_at:162:139; Interrogation_Position=2312; Antisense; ACGATGAACGATATTCGGCTTCCCC
>probe:Drosophila_2:1636868_at:689:267; Interrogation_Position=2341; Antisense; CAGGCTTCAGGCACAAATCGATTTT
>probe:Drosophila_2:1636868_at:69:289; Interrogation_Position=2375; Antisense; CGGCCTGCGGCAAGTTGATTTGTTT
>probe:Drosophila_2:1636868_at:595:421; Interrogation_Position=2454; Antisense; GAGCACAGCGCAATATTAACCCAAA

Paste this into a BLAST search page for me
GATACAGAAACCTAAACCGAACAGTTGTAATTGACTTGGCCACCTAATCCAATCCAGCTGGCATCTAAGCAATTTATTTAATCTCAACGGTTGGCCACGGTGGCCACGGCCACCAAATTGTCATTAATTGTCATTTACTTAGCGCGTCCGACATTTCCCTGTACATTTGTTACGAATTTGTTTACCTTACATCCATGTTTCGTGTGATTCTTATATAGTTTCCATAGTTTCCATTTAGCTTTATATACGAACGATGAACGATATTCGGCTTCCCCCAGGCTTCAGGCACAAATCGATTTTCGGCCTGCGGCAAGTTGATTTGTTTGAGCACAGCGCAATATTAACCCAAA

Full Affymetrix probeset data:

Annotations for 1636868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720