FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636870_at:

>probe:Drosophila_2:1636870_at:170:549; Interrogation_Position=560; Antisense; GGAGAAATCGTCGAAATCCCCGCGA
>probe:Drosophila_2:1636870_at:512:325; Interrogation_Position=581; Antisense; GCGACTCCAATAGGACCTTCTTTTG
>probe:Drosophila_2:1636870_at:385:3; Interrogation_Position=653; Antisense; ATTGTAAGCGACATCGCGGCGTCAA
>probe:Drosophila_2:1636870_at:626:363; Interrogation_Position=691; Antisense; GAATTCTGTGAGGATCGCTTCTGCA
>probe:Drosophila_2:1636870_at:591:653; Interrogation_Position=767; Antisense; TCAAGTGCAGACACTGTTCCCGCAG
>probe:Drosophila_2:1636870_at:282:715; Interrogation_Position=795; Antisense; TTCTGACTACAGCACTCGGTTGAAG
>probe:Drosophila_2:1636870_at:728:637; Interrogation_Position=810; Antisense; TCGGTTGAAGCACGAGCGGACTCAC
>probe:Drosophila_2:1636870_at:535:551; Interrogation_Position=827; Antisense; GGACTCACACTAACGAACGACCTTT
>probe:Drosophila_2:1636870_at:496:381; Interrogation_Position=841; Antisense; GAACGACCTTTTGTCTGCAAGGAGT
>probe:Drosophila_2:1636870_at:696:315; Interrogation_Position=874; Antisense; GCCTTCACAACATCCTATATTCTTA
>probe:Drosophila_2:1636870_at:673:689; Interrogation_Position=891; Antisense; TATTCTTAAGAACCACATGCTCGTG
>probe:Drosophila_2:1636870_at:209:421; Interrogation_Position=925; Antisense; GAGAAGGCTTTTAGGTGCGACCTCT
>probe:Drosophila_2:1636870_at:31:535; Interrogation_Position=938; Antisense; GGTGCGACCTCTGCGATAAGTTATT
>probe:Drosophila_2:1636870_at:709:215; Interrogation_Position=955; Antisense; AAGTTATTCAGTCGCTACACACACC

Paste this into a BLAST search page for me
GGAGAAATCGTCGAAATCCCCGCGAGCGACTCCAATAGGACCTTCTTTTGATTGTAAGCGACATCGCGGCGTCAAGAATTCTGTGAGGATCGCTTCTGCATCAAGTGCAGACACTGTTCCCGCAGTTCTGACTACAGCACTCGGTTGAAGTCGGTTGAAGCACGAGCGGACTCACGGACTCACACTAACGAACGACCTTTGAACGACCTTTTGTCTGCAAGGAGTGCCTTCACAACATCCTATATTCTTATATTCTTAAGAACCACATGCTCGTGGAGAAGGCTTTTAGGTGCGACCTCTGGTGCGACCTCTGCGATAAGTTATTAAGTTATTCAGTCGCTACACACACC

Full Affymetrix probeset data:

Annotations for 1636870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720