FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636871_at:

>probe:Drosophila_2:1636871_at:578:567; Interrogation_Position=1078; Antisense; GGCAGGTATCGCACGCTAATTGAGT
>probe:Drosophila_2:1636871_at:245:471; Interrogation_Position=1108; Antisense; GTTCGATTGCTGTTTCTTTTTCTCA
>probe:Drosophila_2:1636871_at:165:279; Interrogation_Position=1162; Antisense; CTAGCGGCTCTCACGGAACTGGAAG
>probe:Drosophila_2:1636871_at:37:371; Interrogation_Position=1183; Antisense; GAAGGCGCTTTTTCGTTGAGTAACT
>probe:Drosophila_2:1636871_at:714:149; Interrogation_Position=1205; Antisense; ACTTGAATCTTCTATGTCCGGCATT
>probe:Drosophila_2:1636871_at:86:505; Interrogation_Position=1220; Antisense; GTCCGGCATTGATCGATGTGTTCCT
>probe:Drosophila_2:1636871_at:81:683; Interrogation_Position=1302; Antisense; TATCCTGATTGGTCTTATTTTCGGC
>probe:Drosophila_2:1636871_at:578:25; Interrogation_Position=1327; Antisense; ATAGTTGGTTGCACGGTTGCCTTGA
>probe:Drosophila_2:1636871_at:476:315; Interrogation_Position=1345; Antisense; GCCTTGATGCAACTGATCCGTGATT
>probe:Drosophila_2:1636871_at:296:47; Interrogation_Position=1360; Antisense; ATCCGTGATTTTCAGTTGACGCTCA
>probe:Drosophila_2:1636871_at:107:551; Interrogation_Position=838; Antisense; GGAGTCCTCAATCTTGCTGTTTTAT
>probe:Drosophila_2:1636871_at:292:701; Interrogation_Position=857; Antisense; TTTTATTCATCCTGCTCTCGAACAT
>probe:Drosophila_2:1636871_at:82:239; Interrogation_Position=891; Antisense; AATCATCGGCTATTGGCGTTTCGGA
>probe:Drosophila_2:1636871_at:560:229; Interrogation_Position=919; Antisense; AATGTCCATGCCAGTATTACCCTAA

Paste this into a BLAST search page for me
GGCAGGTATCGCACGCTAATTGAGTGTTCGATTGCTGTTTCTTTTTCTCACTAGCGGCTCTCACGGAACTGGAAGGAAGGCGCTTTTTCGTTGAGTAACTACTTGAATCTTCTATGTCCGGCATTGTCCGGCATTGATCGATGTGTTCCTTATCCTGATTGGTCTTATTTTCGGCATAGTTGGTTGCACGGTTGCCTTGAGCCTTGATGCAACTGATCCGTGATTATCCGTGATTTTCAGTTGACGCTCAGGAGTCCTCAATCTTGCTGTTTTATTTTTATTCATCCTGCTCTCGAACATAATCATCGGCTATTGGCGTTTCGGAAATGTCCATGCCAGTATTACCCTAA

Full Affymetrix probeset data:

Annotations for 1636871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720