FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636872_at:

>probe:Drosophila_2:1636872_at:161:143; Interrogation_Position=1022; Antisense; ACTGGCCATGGTGCTGTTCGATATA
>probe:Drosophila_2:1636872_at:200:603; Interrogation_Position=1036; Antisense; TGTTCGATATACCTGACATCCGGCT
>probe:Drosophila_2:1636872_at:96:155; Interrogation_Position=1075; Antisense; ACAGTGGCTTTCTGTCGCAGTTTAG
>probe:Drosophila_2:1636872_at:135:171; Interrogation_Position=1103; Antisense; AAAGGATCTGCACAATCTGCCCAAG
>probe:Drosophila_2:1636872_at:190:685; Interrogation_Position=1146; Antisense; TATCCGCAGTGCACGAATGACTTGT
>probe:Drosophila_2:1636872_at:98:45; Interrogation_Position=1211; Antisense; CTCGCCGAACGACTTTTACGATCTA
>probe:Drosophila_2:1636872_at:540:679; Interrogation_Position=1234; Antisense; TAGTCCGCTCTGTAGCTGGTGATAT
>probe:Drosophila_2:1636872_at:93:559; Interrogation_Position=1306; Antisense; GGAAATCGAGCGTGTGCTTCCGCAT
>probe:Drosophila_2:1636872_at:570:343; Interrogation_Position=1321; Antisense; GCTTCCGCATTGTTTATCGCCATAT
>probe:Drosophila_2:1636872_at:620:683; Interrogation_Position=1335; Antisense; TATCGCCATATGGAGCGCACCTTAA
>probe:Drosophila_2:1636872_at:377:89; Interrogation_Position=1435; Antisense; AGTCATAGTCTAGTTCCGTTTCAAT
>probe:Drosophila_2:1636872_at:481:253; Interrogation_Position=917; Antisense; CAACTGGCTGGAGGTCTTAGGCTGC
>probe:Drosophila_2:1636872_at:469:235; Interrogation_Position=959; Antisense; AATCCTGCAGAGATCGGGCGTTCAT
>probe:Drosophila_2:1636872_at:579:643; Interrogation_Position=980; Antisense; TCATCAATCGATTGGCTACGCCTTT

Paste this into a BLAST search page for me
ACTGGCCATGGTGCTGTTCGATATATGTTCGATATACCTGACATCCGGCTACAGTGGCTTTCTGTCGCAGTTTAGAAAGGATCTGCACAATCTGCCCAAGTATCCGCAGTGCACGAATGACTTGTCTCGCCGAACGACTTTTACGATCTATAGTCCGCTCTGTAGCTGGTGATATGGAAATCGAGCGTGTGCTTCCGCATGCTTCCGCATTGTTTATCGCCATATTATCGCCATATGGAGCGCACCTTAAAGTCATAGTCTAGTTCCGTTTCAATCAACTGGCTGGAGGTCTTAGGCTGCAATCCTGCAGAGATCGGGCGTTCATTCATCAATCGATTGGCTACGCCTTT

Full Affymetrix probeset data:

Annotations for 1636872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720