Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636875_at:

>probe:Drosophila_2:1636875_at:43:103; Interrogation_Position=101; Antisense; AGACCATGTTGGATCACTTTGCCGT
>probe:Drosophila_2:1636875_at:78:259; Interrogation_Position=115; Antisense; CACTTTGCCGTGCAGAACGACGAGA
>probe:Drosophila_2:1636875_at:409:609; Interrogation_Position=164; Antisense; TGAGCACGTTCACCCTGGGCAAGAT
>probe:Drosophila_2:1636875_at:675:525; Interrogation_Position=180; Antisense; GGGCAAGATTCTAGCCTGGGCCAAT
>probe:Drosophila_2:1636875_at:425:607; Interrogation_Position=240; Antisense; TGAGGAGCTGAAGCCACGTCGCCCA
>probe:Drosophila_2:1636875_at:579:527; Interrogation_Position=281; Antisense; GGGACGCCATCTTCTTGATGGTCAA
>probe:Drosophila_2:1636875_at:268:711; Interrogation_Position=306; Antisense; TTCAACCACCTTGCTCGAAATCATA
>probe:Drosophila_2:1636875_at:288:187; Interrogation_Position=341; Antisense; AACAACTGCAGATCAAGGGCCTACT
>probe:Drosophila_2:1636875_at:89:83; Interrogation_Position=356; Antisense; AGGGCCTACTGGAACTCACCTACAA
>probe:Drosophila_2:1636875_at:278:77; Interrogation_Position=416; Antisense; AGGAGATCCGCTTCATCTTCAACAT
>probe:Drosophila_2:1636875_at:418:707; Interrogation_Position=433; Antisense; TTCAACATTCCGGAAGACGTCTCGC
>probe:Drosophila_2:1636875_at:649:559; Interrogation_Position=482; Antisense; GGAAAGACCTGTTTTTGTGGCCCAT
>probe:Drosophila_2:1636875_at:411:477; Interrogation_Position=492; Antisense; GTTTTTGTGGCCCATGGATTTCTGA
>probe:Drosophila_2:1636875_at:27:153; Interrogation_Position=63; Antisense; GACGGAAGTCCGAGTCGCCATGGTC

Paste this into a BLAST search page for me
AGACCATGTTGGATCACTTTGCCGTCACTTTGCCGTGCAGAACGACGAGATGAGCACGTTCACCCTGGGCAAGATGGGCAAGATTCTAGCCTGGGCCAATTGAGGAGCTGAAGCCACGTCGCCCAGGGACGCCATCTTCTTGATGGTCAATTCAACCACCTTGCTCGAAATCATAAACAACTGCAGATCAAGGGCCTACTAGGGCCTACTGGAACTCACCTACAAAGGAGATCCGCTTCATCTTCAACATTTCAACATTCCGGAAGACGTCTCGCGGAAAGACCTGTTTTTGTGGCCCATGTTTTTGTGGCCCATGGATTTCTGAGACGGAAGTCCGAGTCGCCATGGTC

Full Affymetrix probeset data:

Annotations for 1636875_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime