Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636876_at:

>probe:Drosophila_2:1636876_at:714:25; Interrogation_Position=1541; Antisense; ATACGAGCGGCCAAGGACGTCCGGA
>probe:Drosophila_2:1636876_at:303:269; Interrogation_Position=1614; Antisense; CATGGATGTGAAGCCCACGCTGCTG
>probe:Drosophila_2:1636876_at:204:433; Interrogation_Position=1638; Antisense; GAGTGCCCAGCGACAATTGGCCCAG
>probe:Drosophila_2:1636876_at:471:365; Interrogation_Position=1719; Antisense; GAATCAAGCTCAGGGATCCTCCAGG
>probe:Drosophila_2:1636876_at:32:393; Interrogation_Position=1764; Antisense; GAAAGCGGAACCTGCAGTCACTCCA
>probe:Drosophila_2:1636876_at:391:535; Interrogation_Position=1816; Antisense; GGTGCTCGACTGCTAGAACGGATTC
>probe:Drosophila_2:1636876_at:355:583; Interrogation_Position=1856; Antisense; TGGAAAAGACCTCCGACAAGCCCTT
>probe:Drosophila_2:1636876_at:119:585; Interrogation_Position=1895; Antisense; TGGCACGGGCCACTTTTCATTTCGG
>probe:Drosophila_2:1636876_at:295:697; Interrogation_Position=1909; Antisense; TTTCATTTCGGCCAAGCGCGCAGTG
>probe:Drosophila_2:1636876_at:384:437; Interrogation_Position=1972; Antisense; GAGGAGGACAGCTATCAGACGCCAC
>probe:Drosophila_2:1636876_at:331:529; Interrogation_Position=2030; Antisense; GGGTAGGTTTCTTCTCCAAGCTGAC
>probe:Drosophila_2:1636876_at:422:201; Interrogation_Position=2047; Antisense; AAGCTGACCGCACGTTTCGGTCGAA
>probe:Drosophila_2:1636876_at:364:363; Interrogation_Position=2062; Antisense; TTCGGTCGAAGGGTAATCCACTTGA
>probe:Drosophila_2:1636876_at:523:547; Interrogation_Position=2094; Antisense; GGATGTCACCGAGCAGCGCAAGAAC

Paste this into a BLAST search page for me
ATACGAGCGGCCAAGGACGTCCGGACATGGATGTGAAGCCCACGCTGCTGGAGTGCCCAGCGACAATTGGCCCAGGAATCAAGCTCAGGGATCCTCCAGGGAAAGCGGAACCTGCAGTCACTCCAGGTGCTCGACTGCTAGAACGGATTCTGGAAAAGACCTCCGACAAGCCCTTTGGCACGGGCCACTTTTCATTTCGGTTTCATTTCGGCCAAGCGCGCAGTGGAGGAGGACAGCTATCAGACGCCACGGGTAGGTTTCTTCTCCAAGCTGACAAGCTGACCGCACGTTTCGGTCGAATTCGGTCGAAGGGTAATCCACTTGAGGATGTCACCGAGCAGCGCAAGAAC

Full Affymetrix probeset data:

Annotations for 1636876_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime