FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636877_at:

>probe:Drosophila_2:1636877_at:491:427; Interrogation_Position=1003; Antisense; GAGATTATCCTACTGCCATGTGGTC
>probe:Drosophila_2:1636877_at:604:269; Interrogation_Position=1019; Antisense; CATGTGGTCATGTGTGTCTCTGCGA
>probe:Drosophila_2:1636877_at:457:73; Interrogation_Position=1043; Antisense; AGGACTGTGCCCAGAAAATCTCCGT
>probe:Drosophila_2:1636877_at:571:595; Interrogation_Position=1079; Antisense; TGTGTCGTGGTAGCATCGTCTCCAA
>probe:Drosophila_2:1636877_at:252:215; Interrogation_Position=1146; Antisense; AAGATCACCTTGTACCTGTGTGCGC
>probe:Drosophila_2:1636877_at:661:129; Interrogation_Position=1159; Antisense; ACCTGTGTGCGCCAAACTTTTTATT
>probe:Drosophila_2:1636877_at:643:339; Interrogation_Position=656; Antisense; GCTTCCTGACCGCTATTGGTGAACT
>probe:Drosophila_2:1636877_at:422:547; Interrogation_Position=687; Antisense; GGATGGCGATACTCTGCGCATGCAG
>probe:Drosophila_2:1636877_at:604:627; Interrogation_Position=744; Antisense; TGCCACCAAGTCCACGCTTATTAAG
>probe:Drosophila_2:1636877_at:474:397; Interrogation_Position=786; Antisense; GACAACGACGATACTCAAGCTGGTT
>probe:Drosophila_2:1636877_at:521:253; Interrogation_Position=801; Antisense; CAAGCTGGTTGTGTGCAGCACCATC
>probe:Drosophila_2:1636877_at:700:305; Interrogation_Position=834; Antisense; CCTGGTTGCCTTCATTGCCAAGAAA
>probe:Drosophila_2:1636877_at:139:3; Interrogation_Position=898; Antisense; ATTCGCGAACGCCTGGATACGGAGC
>probe:Drosophila_2:1636877_at:18:79; Interrogation_Position=965; Antisense; AGGATCAACTCTGCGTGGTGTGCTC

Paste this into a BLAST search page for me
GAGATTATCCTACTGCCATGTGGTCCATGTGGTCATGTGTGTCTCTGCGAAGGACTGTGCCCAGAAAATCTCCGTTGTGTCGTGGTAGCATCGTCTCCAAAAGATCACCTTGTACCTGTGTGCGCACCTGTGTGCGCCAAACTTTTTATTGCTTCCTGACCGCTATTGGTGAACTGGATGGCGATACTCTGCGCATGCAGTGCCACCAAGTCCACGCTTATTAAGGACAACGACGATACTCAAGCTGGTTCAAGCTGGTTGTGTGCAGCACCATCCCTGGTTGCCTTCATTGCCAAGAAAATTCGCGAACGCCTGGATACGGAGCAGGATCAACTCTGCGTGGTGTGCTC

Full Affymetrix probeset data:

Annotations for 1636877_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720