Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636879_at:

>probe:Drosophila_2:1636879_at:77:31; Interrogation_Position=219; Antisense; ATAAAACACACAATCGGCTTCCTAC
>probe:Drosophila_2:1636879_at:180:417; Interrogation_Position=306; Antisense; GAGCCCGATGAACTGGAGGCCTATC
>probe:Drosophila_2:1636879_at:546:603; Interrogation_Position=349; Antisense; TGTTGCCCATACAACCCGTGTTGAT
>probe:Drosophila_2:1636879_at:679:603; Interrogation_Position=370; Antisense; TGATTTACCCCAAGCCACGTGAGAA
>probe:Drosophila_2:1636879_at:597:69; Interrogation_Position=403; Antisense; AGGCGCGAACTTTAGCTGGACGAAA
>probe:Drosophila_2:1636879_at:253:37; Interrogation_Position=441; Antisense; ATCATCTTTGTGAAGCTGCTGCAGG
>probe:Drosophila_2:1636879_at:104:79; Interrogation_Position=463; Antisense; AGGATAAGTCCCATGGCTATCGGCC
>probe:Drosophila_2:1636879_at:150:115; Interrogation_Position=490; Antisense; AGCAGCAACGTCTCGTCATGGAGGA
>probe:Drosophila_2:1636879_at:323:551; Interrogation_Position=512; Antisense; GGAGACGAAGTCCTCGCAGCGCAAA
>probe:Drosophila_2:1636879_at:157:227; Interrogation_Position=567; Antisense; AAGGCGCTCACCAACGGACGATTTA
>probe:Drosophila_2:1636879_at:74:557; Interrogation_Position=582; Antisense; GGACGATTTAGCCATGAGCGACTGA
>probe:Drosophila_2:1636879_at:500:429; Interrogation_Position=624; Antisense; GAGTTCTACGCCATCAGTGTTTTTA
>probe:Drosophila_2:1636879_at:539:351; Interrogation_Position=666; Antisense; GCAGAGACACCGGTTGTTGGCGATA
>probe:Drosophila_2:1636879_at:566:163; Interrogation_Position=727; Antisense; AAATAAATACCTCAGGCGTGCCCAA

Paste this into a BLAST search page for me
ATAAAACACACAATCGGCTTCCTACGAGCCCGATGAACTGGAGGCCTATCTGTTGCCCATACAACCCGTGTTGATTGATTTACCCCAAGCCACGTGAGAAAGGCGCGAACTTTAGCTGGACGAAAATCATCTTTGTGAAGCTGCTGCAGGAGGATAAGTCCCATGGCTATCGGCCAGCAGCAACGTCTCGTCATGGAGGAGGAGACGAAGTCCTCGCAGCGCAAAAAGGCGCTCACCAACGGACGATTTAGGACGATTTAGCCATGAGCGACTGAGAGTTCTACGCCATCAGTGTTTTTAGCAGAGACACCGGTTGTTGGCGATAAAATAAATACCTCAGGCGTGCCCAA

Full Affymetrix probeset data:

Annotations for 1636879_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime