FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636881_at:

>probe:Drosophila_2:1636881_at:598:623; Interrogation_Position=1024; Antisense; TGCGCCACCTGGCTAACCGGAATGG
>probe:Drosophila_2:1636881_at:57:125; Interrogation_Position=1039; Antisense; ACCGGAATGGTTATTGCCCTGCCCT
>probe:Drosophila_2:1636881_at:614:271; Interrogation_Position=1068; Antisense; CATCTACACCATCTACGTGGAGCTA
>probe:Drosophila_2:1636881_at:677:509; Interrogation_Position=1096; Antisense; GTGAGTATGAGCACGCTCCTACCAT
>probe:Drosophila_2:1636881_at:383:307; Interrogation_Position=1113; Antisense; CCTACCATCGAGCACTTGTTACATT
>probe:Drosophila_2:1636881_at:419:111; Interrogation_Position=1148; Antisense; AGCAAGCAGTGCTCCTGGTTGCCAG
>probe:Drosophila_2:1636881_at:675:539; Interrogation_Position=1164; Antisense; GGTTGCCAGGGCTGATCAAAGCGAA
>probe:Drosophila_2:1636881_at:98:21; Interrogation_Position=605; Antisense; ATATTGGTGTGGTGTCCTTGCATGA
>probe:Drosophila_2:1636881_at:194:723; Interrogation_Position=622; Antisense; TTGCATGAGGCATGTCCCTTTCCAA
>probe:Drosophila_2:1636881_at:23:503; Interrogation_Position=635; Antisense; GTCCCTTTCCAACGTTCGAGAAGAT
>probe:Drosophila_2:1636881_at:634:97; Interrogation_Position=905; Antisense; AGATCGTGGAAGACATACCGCTGCA
>probe:Drosophila_2:1636881_at:40:29; Interrogation_Position=919; Antisense; ATACCGCTGCACGTGGCCATGATCT
>probe:Drosophila_2:1636881_at:92:47; Interrogation_Position=949; Antisense; ATCCTGATCGCCTGGGACCGGATGC
>probe:Drosophila_2:1636881_at:147:413; Interrogation_Position=964; Antisense; GACCGGATGCGCTGGCTGAACGATC

Paste this into a BLAST search page for me
TGCGCCACCTGGCTAACCGGAATGGACCGGAATGGTTATTGCCCTGCCCTCATCTACACCATCTACGTGGAGCTAGTGAGTATGAGCACGCTCCTACCATCCTACCATCGAGCACTTGTTACATTAGCAAGCAGTGCTCCTGGTTGCCAGGGTTGCCAGGGCTGATCAAAGCGAAATATTGGTGTGGTGTCCTTGCATGATTGCATGAGGCATGTCCCTTTCCAAGTCCCTTTCCAACGTTCGAGAAGATAGATCGTGGAAGACATACCGCTGCAATACCGCTGCACGTGGCCATGATCTATCCTGATCGCCTGGGACCGGATGCGACCGGATGCGCTGGCTGAACGATC

Full Affymetrix probeset data:

Annotations for 1636881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720