FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636885_at:

>probe:Drosophila_2:1636885_at:131:253; Interrogation_Position=1029; Antisense; CAAGATGCTGTGGTATCCCTTCGTC
>probe:Drosophila_2:1636885_at:405:379; Interrogation_Position=1152; Antisense; GAAGCCCATACTCGTGGATCTGTAT
>probe:Drosophila_2:1636885_at:612:95; Interrogation_Position=1181; Antisense; AGATTCACAAGAACATCGCCGTCCT
>probe:Drosophila_2:1636885_at:641:487; Interrogation_Position=1220; Antisense; GTACCACCTGGAACTTTGACATGAC
>probe:Drosophila_2:1636885_at:166:441; Interrogation_Position=1269; Antisense; GATGTCCAAGCAGGATCGCAACCTT
>probe:Drosophila_2:1636885_at:181:633; Interrogation_Position=1284; Antisense; TCGCAACCTTTACGACTTCGACATG
>probe:Drosophila_2:1636885_at:701:55; Interrogation_Position=1325; Antisense; ATGACTATTTCAAGGCCGCCATGTA
>probe:Drosophila_2:1636885_at:455:313; Interrogation_Position=1342; Antisense; GCCATGTATGGAATGCGTCTCTATA
>probe:Drosophila_2:1636885_at:427:723; Interrogation_Position=1367; Antisense; TTGGCAAGGAGAAACCCACCGCGGA
>probe:Drosophila_2:1636885_at:53:331; Interrogation_Position=1387; Antisense; GCGGAGTCCATTGCCAAGGGTCTGA
>probe:Drosophila_2:1636885_at:464:223; Interrogation_Position=1429; Antisense; AAGGTCCTTCACTATGCATTCGCAT
>probe:Drosophila_2:1636885_at:74:541; Interrogation_Position=1461; Antisense; GGTTGCTTTAGCTGGTTACATCCTG
>probe:Drosophila_2:1636885_at:462:709; Interrogation_Position=1476; Antisense; TTACATCCTGTATTCTCTGGCCAGA
>probe:Drosophila_2:1636885_at:292:17; Interrogation_Position=937; Antisense; ATTTACGCGTTTGCACCTAGCGAGA

Paste this into a BLAST search page for me
CAAGATGCTGTGGTATCCCTTCGTCGAAGCCCATACTCGTGGATCTGTATAGATTCACAAGAACATCGCCGTCCTGTACCACCTGGAACTTTGACATGACGATGTCCAAGCAGGATCGCAACCTTTCGCAACCTTTACGACTTCGACATGATGACTATTTCAAGGCCGCCATGTAGCCATGTATGGAATGCGTCTCTATATTGGCAAGGAGAAACCCACCGCGGAGCGGAGTCCATTGCCAAGGGTCTGAAAGGTCCTTCACTATGCATTCGCATGGTTGCTTTAGCTGGTTACATCCTGTTACATCCTGTATTCTCTGGCCAGAATTTACGCGTTTGCACCTAGCGAGA

Full Affymetrix probeset data:

Annotations for 1636885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720