FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636886_at:

>probe:Drosophila_2:1636886_at:586:277; Interrogation_Position=4094; Antisense; CTACCACTGCCGAATGAACCTTTTG
>probe:Drosophila_2:1636886_at:29:215; Interrogation_Position=4121; Antisense; AAGAGGGCCATATTTCCGATGCACT
>probe:Drosophila_2:1636886_at:49:447; Interrogation_Position=4138; Antisense; GATGCACTCACTTACTGAGCTCCAA
>probe:Drosophila_2:1636886_at:19:399; Interrogation_Position=4169; Antisense; GACACGGGTCGCTTGGTGCAACTGA
>probe:Drosophila_2:1636886_at:509:423; Interrogation_Position=4196; Antisense; GAGAACTGCAGCATGTTGCACAAAT
>probe:Drosophila_2:1636886_at:156:229; Interrogation_Position=4218; Antisense; AATGGCGCAACTTCGAAGGCACTTT
>probe:Drosophila_2:1636886_at:123:143; Interrogation_Position=4238; Antisense; ACTTTACCCCATATGACTTGCAAAC
>probe:Drosophila_2:1636886_at:388:95; Interrogation_Position=4272; Antisense; AGTTGTTGGAATCGGTTCCCCAGCT
>probe:Drosophila_2:1636886_at:135:481; Interrogation_Position=4299; Antisense; GTTTGCATCTCCTGACCATATTGCA
>probe:Drosophila_2:1636886_at:675:413; Interrogation_Position=4312; Antisense; GACCATATTGCATCGTGATCGTGAA
>probe:Drosophila_2:1636886_at:127:693; Interrogation_Position=4408; Antisense; TTTGATTTCTCATTTCTTTTCTTAA
>probe:Drosophila_2:1636886_at:642:225; Interrogation_Position=4432; Antisense; AAGGACACACTTCACTTGTTTGGTT
>probe:Drosophila_2:1636886_at:397:369; Interrogation_Position=4553; Antisense; GAATGATCTCTCTTCGTTCAATTAC
>probe:Drosophila_2:1636886_at:710:399; Interrogation_Position=4643; Antisense; GACAGCTATACTAACCAGTTCATTA

Paste this into a BLAST search page for me
CTACCACTGCCGAATGAACCTTTTGAAGAGGGCCATATTTCCGATGCACTGATGCACTCACTTACTGAGCTCCAAGACACGGGTCGCTTGGTGCAACTGAGAGAACTGCAGCATGTTGCACAAATAATGGCGCAACTTCGAAGGCACTTTACTTTACCCCATATGACTTGCAAACAGTTGTTGGAATCGGTTCCCCAGCTGTTTGCATCTCCTGACCATATTGCAGACCATATTGCATCGTGATCGTGAATTTGATTTCTCATTTCTTTTCTTAAAAGGACACACTTCACTTGTTTGGTTGAATGATCTCTCTTCGTTCAATTACGACAGCTATACTAACCAGTTCATTA

Full Affymetrix probeset data:

Annotations for 1636886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720