FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636892_at:

>probe:Drosophila_2:1636892_at:77:667; Interrogation_Position=134; Antisense; TACAGAAGCGTTCCAGAGCGGCCAA
>probe:Drosophila_2:1636892_at:141:721; Interrogation_Position=160; Antisense; TTCCGGCTGACCTTCCAGCAGAAAT
>probe:Drosophila_2:1636892_at:499:5; Interrogation_Position=183; Antisense; ATTGAATGCCAGCAGTACGCATCTG
>probe:Drosophila_2:1636892_at:393:135; Interrogation_Position=199; Antisense; ACGCATCTGGACTGGGAGAACACCT
>probe:Drosophila_2:1636892_at:483:423; Interrogation_Position=214; Antisense; GAGAACACCTGCAATCTGAAGCCCA
>probe:Drosophila_2:1636892_at:363:377; Interrogation_Position=231; Antisense; GAAGCCCACGGGTCTGAACGAAACG
>probe:Drosophila_2:1636892_at:418:389; Interrogation_Position=279; Antisense; GAAACGCCAAAGGATCCTGCAGAAT
>probe:Drosophila_2:1636892_at:226:31; Interrogation_Position=302; Antisense; ATCTACAGAACCAAACGGGCCGCGA
>probe:Drosophila_2:1636892_at:673:227; Interrogation_Position=352; Antisense; AAGGCCAGGATCACCACCAATGCGG
>probe:Drosophila_2:1636892_at:48:233; Interrogation_Position=370; Antisense; AATGCGGACAAGCTGGCCACAGTGA
>probe:Drosophila_2:1636892_at:463:511; Interrogation_Position=391; Antisense; GTGAGCACCAAGACTCTGGACATTG
>probe:Drosophila_2:1636892_at:156:81; Interrogation_Position=443; Antisense; AGGGAAACTACAGATTCCTGCCCCG
>probe:Drosophila_2:1636892_at:38:303; Interrogation_Position=464; Antisense; CCCGTCTGAATCTCACTAGCAAACA
>probe:Drosophila_2:1636892_at:79:155; Interrogation_Position=486; Antisense; ACAGGTGAGTGTCGTCCATATGCCA

Paste this into a BLAST search page for me
TACAGAAGCGTTCCAGAGCGGCCAATTCCGGCTGACCTTCCAGCAGAAATATTGAATGCCAGCAGTACGCATCTGACGCATCTGGACTGGGAGAACACCTGAGAACACCTGCAATCTGAAGCCCAGAAGCCCACGGGTCTGAACGAAACGGAAACGCCAAAGGATCCTGCAGAATATCTACAGAACCAAACGGGCCGCGAAAGGCCAGGATCACCACCAATGCGGAATGCGGACAAGCTGGCCACAGTGAGTGAGCACCAAGACTCTGGACATTGAGGGAAACTACAGATTCCTGCCCCGCCCGTCTGAATCTCACTAGCAAACAACAGGTGAGTGTCGTCCATATGCCA

Full Affymetrix probeset data:

Annotations for 1636892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720