FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636895_at:

>probe:Drosophila_2:1636895_at:671:191; Interrogation_Position=1000; Antisense; AACGGGCTGTACGAGACCAACTGGA
>probe:Drosophila_2:1636895_at:606:219; Interrogation_Position=1096; Antisense; AAGGGCTACTTTTTCGAGGCCAGCA
>probe:Drosophila_2:1636895_at:182:643; Interrogation_Position=1147; Antisense; TCTGCCGTGTCGTACATCATGATGT
>probe:Drosophila_2:1636895_at:355:443; Interrogation_Position=1167; Antisense; GATGTTGCGCTCCTTTAATGCCTAA
>probe:Drosophila_2:1636895_at:55:601; Interrogation_Position=615; Antisense; TGTAACCATGGCACTCTGCGTGGAC
>probe:Drosophila_2:1636895_at:508:253; Interrogation_Position=663; Antisense; CAACGTGTGCGCCATTTTCAAGATC
>probe:Drosophila_2:1636895_at:357:653; Interrogation_Position=680; Antisense; TCAAGATCGCCAAGCACCGGATGAT
>probe:Drosophila_2:1636895_at:707:97; Interrogation_Position=782; Antisense; AGATCGCCGATCACATTGCGGACAA
>probe:Drosophila_2:1636895_at:34:39; Interrogation_Position=820; Antisense; ATCTTTTTGCAGTTCTTTCTGTCCG
>probe:Drosophila_2:1636895_at:77:617; Interrogation_Position=848; Antisense; TGCAGATCTGCTTCATTGGATTCCA
>probe:Drosophila_2:1636895_at:84:81; Interrogation_Position=872; Antisense; AGGTGGCTGATCTGTTTCCCAATCC
>probe:Drosophila_2:1636895_at:212:101; Interrogation_Position=899; Antisense; AGAGTCTCTACTTTATCGCCTTTGT
>probe:Drosophila_2:1636895_at:154:45; Interrogation_Position=937; Antisense; ATCGCACTGTTCATCTACTCGAAGT
>probe:Drosophila_2:1636895_at:168:503; Interrogation_Position=980; Antisense; GTGCCAGCCTGGATTTCGGAAACGG

Paste this into a BLAST search page for me
AACGGGCTGTACGAGACCAACTGGAAAGGGCTACTTTTTCGAGGCCAGCATCTGCCGTGTCGTACATCATGATGTGATGTTGCGCTCCTTTAATGCCTAATGTAACCATGGCACTCTGCGTGGACCAACGTGTGCGCCATTTTCAAGATCTCAAGATCGCCAAGCACCGGATGATAGATCGCCGATCACATTGCGGACAAATCTTTTTGCAGTTCTTTCTGTCCGTGCAGATCTGCTTCATTGGATTCCAAGGTGGCTGATCTGTTTCCCAATCCAGAGTCTCTACTTTATCGCCTTTGTATCGCACTGTTCATCTACTCGAAGTGTGCCAGCCTGGATTTCGGAAACGG

Full Affymetrix probeset data:

Annotations for 1636895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720