Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636897_at:

>probe:Drosophila_2:1636897_at:108:243; Interrogation_Position=1183; Antisense; AATATGGAGTATGCCACACCACCGC
>probe:Drosophila_2:1636897_at:656:541; Interrogation_Position=1210; Antisense; GGTTGGCTGCAATCTCACCCAGAAT
>probe:Drosophila_2:1636897_at:39:635; Interrogation_Position=1242; Antisense; TCCCAAGCCGGATGATCACGATCAC
>probe:Drosophila_2:1636897_at:128:675; Interrogation_Position=1333; Antisense; TACCAGCCCTCGTATCCGGATGATT
>probe:Drosophila_2:1636897_at:568:547; Interrogation_Position=1350; Antisense; GGATGATTCCTATCCGGATGTCATT
>probe:Drosophila_2:1636897_at:297:301; Interrogation_Position=1490; Antisense; CGCCACCAGAGCCACGTGTGAAGAA
>probe:Drosophila_2:1636897_at:459:263; Interrogation_Position=1518; Antisense; CAGCTACTTCTACATTGGCCGCAAG
>probe:Drosophila_2:1636897_at:164:3; Interrogation_Position=1531; Antisense; ATTGGCCGCAAGCTCTGGTACATCC
>probe:Drosophila_2:1636897_at:294:667; Interrogation_Position=1561; Antisense; TACTTTACGGTGTGGTTCAGCTTCT
>probe:Drosophila_2:1636897_at:205:117; Interrogation_Position=1579; Antisense; AGCTTCTACATCCTGTGGCTGATCA
>probe:Drosophila_2:1636897_at:452:583; Interrogation_Position=1594; Antisense; TGGCTGATCATCAAGTCCATCGGTC
>probe:Drosophila_2:1636897_at:174:219; Interrogation_Position=1606; Antisense; AAGTCCATCGGTCGCCACAAAGTGA
>probe:Drosophila_2:1636897_at:491:239; Interrogation_Position=1639; Antisense; AATCACTACGTCTCGCGACGCAGTG
>probe:Drosophila_2:1636897_at:650:607; Interrogation_Position=1712; Antisense; TGACGGTCAGGGTGCTGGAACACAT

Paste this into a BLAST search page for me
AATATGGAGTATGCCACACCACCGCGGTTGGCTGCAATCTCACCCAGAATTCCCAAGCCGGATGATCACGATCACTACCAGCCCTCGTATCCGGATGATTGGATGATTCCTATCCGGATGTCATTCGCCACCAGAGCCACGTGTGAAGAACAGCTACTTCTACATTGGCCGCAAGATTGGCCGCAAGCTCTGGTACATCCTACTTTACGGTGTGGTTCAGCTTCTAGCTTCTACATCCTGTGGCTGATCATGGCTGATCATCAAGTCCATCGGTCAAGTCCATCGGTCGCCACAAAGTGAAATCACTACGTCTCGCGACGCAGTGTGACGGTCAGGGTGCTGGAACACAT

Full Affymetrix probeset data:

Annotations for 1636897_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime