FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636898_at:

>probe:Drosophila_2:1636898_at:339:591; Interrogation_Position=231; Antisense; TGAGTGGTTGCGAGCTCCATAGGTC
>probe:Drosophila_2:1636898_at:406:567; Interrogation_Position=301; Antisense; GGCAGTACCCTTGTTTGTGGATCAT
>probe:Drosophila_2:1636898_at:565:519; Interrogation_Position=317; Antisense; GTGGATCATCGCAAATTGGCTTACA
>probe:Drosophila_2:1636898_at:349:575; Interrogation_Position=360; Antisense; GGCGATCTAGCTTGAACCTGGTGGA
>probe:Drosophila_2:1636898_at:723:99; Interrogation_Position=399; Antisense; AGAGGAACTTCACTACCACCAATAC
>probe:Drosophila_2:1636898_at:429:73; Interrogation_Position=435; Antisense; AGGAAATTCCTCGACTGCGTCTTAT
>probe:Drosophila_2:1636898_at:579:209; Interrogation_Position=497; Antisense; AAGCAGCCGCTGGACGTGGACAGAC
>probe:Drosophila_2:1636898_at:676:519; Interrogation_Position=512; Antisense; GTGGACAGACTGCAAGCCTTCGGAA
>probe:Drosophila_2:1636898_at:32:675; Interrogation_Position=557; Antisense; TACCTCTTTCGGTTCAAGTGCGAGA
>probe:Drosophila_2:1636898_at:636:425; Interrogation_Position=593; Antisense; GAGATCAGTAACATGCAGACCACCT
>probe:Drosophila_2:1636898_at:628:627; Interrogation_Position=620; Antisense; TCCGCGAGCTTTAACCGACCGTGGG
>probe:Drosophila_2:1636898_at:452:241; Interrogation_Position=663; Antisense; AATTTGGTCCAGACTACGACGGAGT
>probe:Drosophila_2:1636898_at:642:479; Interrogation_Position=694; Antisense; GTTTGACTTGACGTGCTAGCAGCCA
>probe:Drosophila_2:1636898_at:699:703; Interrogation_Position=778; Antisense; TTGCAACCGTCTTCCCAAAGAAACT

Paste this into a BLAST search page for me
TGAGTGGTTGCGAGCTCCATAGGTCGGCAGTACCCTTGTTTGTGGATCATGTGGATCATCGCAAATTGGCTTACAGGCGATCTAGCTTGAACCTGGTGGAAGAGGAACTTCACTACCACCAATACAGGAAATTCCTCGACTGCGTCTTATAAGCAGCCGCTGGACGTGGACAGACGTGGACAGACTGCAAGCCTTCGGAATACCTCTTTCGGTTCAAGTGCGAGAGAGATCAGTAACATGCAGACCACCTTCCGCGAGCTTTAACCGACCGTGGGAATTTGGTCCAGACTACGACGGAGTGTTTGACTTGACGTGCTAGCAGCCATTGCAACCGTCTTCCCAAAGAAACT

Full Affymetrix probeset data:

Annotations for 1636898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720