Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636900_at:

>probe:Drosophila_2:1636900_at:689:193; Interrogation_Position=1044; Antisense; AACTCGACTCGGCAGGCATTTCATT
>probe:Drosophila_2:1636900_at:53:19; Interrogation_Position=1061; Antisense; ATTTCATTCTGCACGACAGCTTCAT
>probe:Drosophila_2:1636900_at:54:359; Interrogation_Position=1118; Antisense; GCAAGGGTGATGGTGGCTCCCCACT
>probe:Drosophila_2:1636900_at:84:593; Interrogation_Position=1142; Antisense; TGGTGTGTCCAATTGCTGGCCAGAA
>probe:Drosophila_2:1636900_at:238:611; Interrogation_Position=1220; Antisense; TGAACATTCCCGGAGTGTACGCCAG
>probe:Drosophila_2:1636900_at:395:503; Interrogation_Position=1259; Antisense; GTCCGTGGATCGACGCCAAGTTGAA
>probe:Drosophila_2:1636900_at:138:693; Interrogation_Position=1286; Antisense; TTTGGAGTATTGACCCCAGGCACTA
>probe:Drosophila_2:1636900_at:147:531; Interrogation_Position=1346; Antisense; GGGTTTTAATCTTCATGCTTCACAA
>probe:Drosophila_2:1636900_at:391:53; Interrogation_Position=1360; Antisense; ATGCTTCACAATGCTCTCACTTAAT
>probe:Drosophila_2:1636900_at:41:139; Interrogation_Position=824; Antisense; ACGATGTGGCTGTCATGCTGTTGGA
>probe:Drosophila_2:1636900_at:446:601; Interrogation_Position=842; Antisense; TGTTGGAAAGTCCATTCACCCTCCA
>probe:Drosophila_2:1636900_at:414:423; Interrogation_Position=868; Antisense; GAGAACATTCAGACCGTTTGCCTGC
>probe:Drosophila_2:1636900_at:349:479; Interrogation_Position=883; Antisense; GTTTGCCTGCCCAATGTGGGTGATA
>probe:Drosophila_2:1636900_at:653:209; Interrogation_Position=988; Antisense; AAGAAGGTCGACATGCCCGTGGTGC

Paste this into a BLAST search page for me
AACTCGACTCGGCAGGCATTTCATTATTTCATTCTGCACGACAGCTTCATGCAAGGGTGATGGTGGCTCCCCACTTGGTGTGTCCAATTGCTGGCCAGAATGAACATTCCCGGAGTGTACGCCAGGTCCGTGGATCGACGCCAAGTTGAATTTGGAGTATTGACCCCAGGCACTAGGGTTTTAATCTTCATGCTTCACAAATGCTTCACAATGCTCTCACTTAATACGATGTGGCTGTCATGCTGTTGGATGTTGGAAAGTCCATTCACCCTCCAGAGAACATTCAGACCGTTTGCCTGCGTTTGCCTGCCCAATGTGGGTGATAAAGAAGGTCGACATGCCCGTGGTGC

Full Affymetrix probeset data:

Annotations for 1636900_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime