FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636902_at:

>probe:Drosophila_2:1636902_at:310:675; Interrogation_Position=141; Antisense; TAGCTTTAAAATGGCGTACGTCGAT
>probe:Drosophila_2:1636902_at:679:487; Interrogation_Position=156; Antisense; GTACGTCGATCAAAATGGTCGTCTG
>probe:Drosophila_2:1636902_at:331:537; Interrogation_Position=172; Antisense; GGTCGTCTGTGGGAGAAACGTCCAT
>probe:Drosophila_2:1636902_at:172:275; Interrogation_Position=201; Antisense; CTTGAGACGAGTTTTGGACACATTC
>probe:Drosophila_2:1636902_at:241:9; Interrogation_Position=222; Antisense; ATTCGTGGGTATATGGTTCGCCGTC
>probe:Drosophila_2:1636902_at:508:57; Interrogation_Position=234; Antisense; ATGGTTCGCCGTCAAACAGTTGCTT
>probe:Drosophila_2:1636902_at:380:179; Interrogation_Position=247; Antisense; AAACAGTTGCTTGCATCGTTCCTGT
>probe:Drosophila_2:1636902_at:152:471; Interrogation_Position=264; Antisense; GTTCCTGTCTCCATTCACTGGAAAT
>probe:Drosophila_2:1636902_at:511:455; Interrogation_Position=301; Antisense; GATAACTCCCGTCGAGGAAATGGAT
>probe:Drosophila_2:1636902_at:717:233; Interrogation_Position=442; Antisense; AATCGACGAATTGGGCGCATTCCGC
>probe:Drosophila_2:1636902_at:332:249; Interrogation_Position=475; Antisense; CAATCCTGCAATGCCGGAGGATGCT
>probe:Drosophila_2:1636902_at:338:621; Interrogation_Position=496; Antisense; TGCTGCGGCTGAGCTGCTTAACCAA
>probe:Drosophila_2:1636902_at:257:333; Interrogation_Position=508; Antisense; GCTGCTTAACCAAAATGCTCCAATA
>probe:Drosophila_2:1636902_at:44:165; Interrogation_Position=532; Antisense; AAATAATCCAACTCACCTCTGTGAT

Paste this into a BLAST search page for me
TAGCTTTAAAATGGCGTACGTCGATGTACGTCGATCAAAATGGTCGTCTGGGTCGTCTGTGGGAGAAACGTCCATCTTGAGACGAGTTTTGGACACATTCATTCGTGGGTATATGGTTCGCCGTCATGGTTCGCCGTCAAACAGTTGCTTAAACAGTTGCTTGCATCGTTCCTGTGTTCCTGTCTCCATTCACTGGAAATGATAACTCCCGTCGAGGAAATGGATAATCGACGAATTGGGCGCATTCCGCCAATCCTGCAATGCCGGAGGATGCTTGCTGCGGCTGAGCTGCTTAACCAAGCTGCTTAACCAAAATGCTCCAATAAAATAATCCAACTCACCTCTGTGAT

Full Affymetrix probeset data:

Annotations for 1636902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720