Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636905_at:

>probe:Drosophila_2:1636905_at:696:323; Interrogation_Position=4816; Antisense; GCGAACGCTTCAACAACGGTGGAGT
>probe:Drosophila_2:1636905_at:580:105; Interrogation_Position=4843; Antisense; AGAACTTTGAGTAGCCTGGTTAGGA
>probe:Drosophila_2:1636905_at:428:357; Interrogation_Position=5058; Antisense; GCAAAGTATTTCTTGACCCTCCAAA
>probe:Drosophila_2:1636905_at:621:411; Interrogation_Position=5072; Antisense; GACCCTCCAAAATTCACTGCACTGA
>probe:Drosophila_2:1636905_at:701:615; Interrogation_Position=5089; Antisense; TGCACTGAACTTTGCTTGTTCCCTG
>probe:Drosophila_2:1636905_at:437:719; Interrogation_Position=5107; Antisense; TTCCCTGCTGCGTTTGTCACAAATG
>probe:Drosophila_2:1636905_at:206:405; Interrogation_Position=5152; Antisense; GACTGACAGAGTGCGAGATTCGTGT
>probe:Drosophila_2:1636905_at:176:161; Interrogation_Position=5205; Antisense; ACAAGGTTTCGTTTCTATGTGAAGA
>probe:Drosophila_2:1636905_at:487:105; Interrogation_Position=5227; Antisense; AGAAAGCCGAGCTCTTAACTCTGAG
>probe:Drosophila_2:1636905_at:568:303; Interrogation_Position=5252; Antisense; CCGTCGGCCCTATGCTAGTGATAGA
>probe:Drosophila_2:1636905_at:719:105; Interrogation_Position=5274; Antisense; AGACATATTACTCTTTCTCCATCTC
>probe:Drosophila_2:1636905_at:42:655; Interrogation_Position=5305; Antisense; TCAATCTATCTCTACTCGCGCTAAT
>probe:Drosophila_2:1636905_at:294:635; Interrogation_Position=5320; Antisense; TCGCGCTAATCTCCGACTAGGAACT
>probe:Drosophila_2:1636905_at:41:363; Interrogation_Position=5334; Antisense; GACTAGGAACTGCTTTCGTTAAACT

Paste this into a BLAST search page for me
GCGAACGCTTCAACAACGGTGGAGTAGAACTTTGAGTAGCCTGGTTAGGAGCAAAGTATTTCTTGACCCTCCAAAGACCCTCCAAAATTCACTGCACTGATGCACTGAACTTTGCTTGTTCCCTGTTCCCTGCTGCGTTTGTCACAAATGGACTGACAGAGTGCGAGATTCGTGTACAAGGTTTCGTTTCTATGTGAAGAAGAAAGCCGAGCTCTTAACTCTGAGCCGTCGGCCCTATGCTAGTGATAGAAGACATATTACTCTTTCTCCATCTCTCAATCTATCTCTACTCGCGCTAATTCGCGCTAATCTCCGACTAGGAACTGACTAGGAACTGCTTTCGTTAAACT

Full Affymetrix probeset data:

Annotations for 1636905_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime