FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636907_at:

>probe:Drosophila_2:1636907_at:125:655; Interrogation_Position=105; Antisense; TCAATTCGACGAGCAGTCTGACCGC
>probe:Drosophila_2:1636907_at:150:595; Interrogation_Position=144; Antisense; TGGGCGTGGGCCATCATCCAAACAT
>probe:Drosophila_2:1636907_at:204:197; Interrogation_Position=193; Antisense; AACGGCAACGGGAACAATGACATCA
>probe:Drosophila_2:1636907_at:314:33; Interrogation_Position=214; Antisense; ATCAACGCCCGGAAAATGCATTCTA
>probe:Drosophila_2:1636907_at:427:687; Interrogation_Position=237; Antisense; TATTTCCGGATAAGACGGCCTCCCT
>probe:Drosophila_2:1636907_at:134:579; Interrogation_Position=253; Antisense; GGCCTCCCTGAAAAGCTCTATGTAT
>probe:Drosophila_2:1636907_at:160:119; Interrogation_Position=266; Antisense; AGCTCTATGTATACGCAACAGGTGT
>probe:Drosophila_2:1636907_at:442:189; Interrogation_Position=282; Antisense; AACAGGTGTACTTCAGGCCCGATAT
>probe:Drosophila_2:1636907_at:49:713; Interrogation_Position=293; Antisense; TTCAGGCCCGATATGGCGACATAGC
>probe:Drosophila_2:1636907_at:469:233; Interrogation_Position=320; Antisense; AATGCCAGCAATTGACTTTGCCAAG
>probe:Drosophila_2:1636907_at:83:527; Interrogation_Position=378; Antisense; GGGACAAGTGCACCACAAAATCAGT
>probe:Drosophila_2:1636907_at:345:391; Interrogation_Position=44; Antisense; GAAACGGCGCCCTGGCATCAGATGT
>probe:Drosophila_2:1636907_at:672:595; Interrogation_Position=66; Antisense; TGTGGACGCACATGAAACGCCTCTC
>probe:Drosophila_2:1636907_at:170:351; Interrogation_Position=91; Antisense; GCACGCCTCCAAAGTCAATTCGACG

Paste this into a BLAST search page for me
TCAATTCGACGAGCAGTCTGACCGCTGGGCGTGGGCCATCATCCAAACATAACGGCAACGGGAACAATGACATCAATCAACGCCCGGAAAATGCATTCTATATTTCCGGATAAGACGGCCTCCCTGGCCTCCCTGAAAAGCTCTATGTATAGCTCTATGTATACGCAACAGGTGTAACAGGTGTACTTCAGGCCCGATATTTCAGGCCCGATATGGCGACATAGCAATGCCAGCAATTGACTTTGCCAAGGGGACAAGTGCACCACAAAATCAGTGAAACGGCGCCCTGGCATCAGATGTTGTGGACGCACATGAAACGCCTCTCGCACGCCTCCAAAGTCAATTCGACG

Full Affymetrix probeset data:

Annotations for 1636907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720