FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636909_at:

>probe:Drosophila_2:1636909_at:392:9; Interrogation_Position=2725; Antisense; ATTCACAAGCGGGAGCGAAGCTCAC
>probe:Drosophila_2:1636909_at:112:369; Interrogation_Position=2761; Antisense; GAATCCTCCAGCCAGGTGACCAAAA
>probe:Drosophila_2:1636909_at:500:677; Interrogation_Position=2826; Antisense; TAGTTCGCAGGCTAAGGAGGCACCC
>probe:Drosophila_2:1636909_at:99:477; Interrogation_Position=2865; Antisense; GTTTCTCCGGGAGCTACGCAGCCTG
>probe:Drosophila_2:1636909_at:587:353; Interrogation_Position=2882; Antisense; GCAGCCTGGTCACCCAAGATCAATT
>probe:Drosophila_2:1636909_at:443:251; Interrogation_Position=2919; Antisense; CAAGGCGCTGCTGGAGTACAAGAAT
>probe:Drosophila_2:1636909_at:660:277; Interrogation_Position=2949; Antisense; CTATGAGAGCTTTCAGGCCCTGATG
>probe:Drosophila_2:1636909_at:417:69; Interrogation_Position=2971; Antisense; ATGGCCATACTCCTGGATGTCCTGT
>probe:Drosophila_2:1636909_at:430:339; Interrogation_Position=3011; Antisense; GCTACATGCTCGTCGGGATGCGGAA
>probe:Drosophila_2:1636909_at:213:599; Interrogation_Position=3066; Antisense; TGATCGTAGGGTGGGCAATCTTTAA
>probe:Drosophila_2:1636909_at:95:695; Interrogation_Position=3120; Antisense; TTTCAAGTTTAGTCGTCCCAAGGAT
>probe:Drosophila_2:1636909_at:299:403; Interrogation_Position=3173; Antisense; GACATTGGCTGTAATTTTCTGATTG
>probe:Drosophila_2:1636909_at:633:523; Interrogation_Position=3207; Antisense; GGGCGCGTCTAATTCTCCTAAGAAT
>probe:Drosophila_2:1636909_at:327:345; Interrogation_Position=3267; Antisense; GCATTTTGAATTTCTCTGTACGGAT

Paste this into a BLAST search page for me
ATTCACAAGCGGGAGCGAAGCTCACGAATCCTCCAGCCAGGTGACCAAAATAGTTCGCAGGCTAAGGAGGCACCCGTTTCTCCGGGAGCTACGCAGCCTGGCAGCCTGGTCACCCAAGATCAATTCAAGGCGCTGCTGGAGTACAAGAATCTATGAGAGCTTTCAGGCCCTGATGATGGCCATACTCCTGGATGTCCTGTGCTACATGCTCGTCGGGATGCGGAATGATCGTAGGGTGGGCAATCTTTAATTTCAAGTTTAGTCGTCCCAAGGATGACATTGGCTGTAATTTTCTGATTGGGGCGCGTCTAATTCTCCTAAGAATGCATTTTGAATTTCTCTGTACGGAT

Full Affymetrix probeset data:

Annotations for 1636909_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720