FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636910_at:

>probe:Drosophila_2:1636910_at:590:727; Interrogation_Position=116; Antisense; TTGGCTAAGAAGTGCTCCACCTACT
>probe:Drosophila_2:1636910_at:613:261; Interrogation_Position=133; Antisense; CACCTACTTGGTGATATGCCTGGTA
>probe:Drosophila_2:1636910_at:44:25; Interrogation_Position=146; Antisense; ATATGCCTGGTACTGTTGGCCTGCT
>probe:Drosophila_2:1636910_at:74:361; Interrogation_Position=175; Antisense; GCAAGAATCGGAGGCCACGCGACGT
>probe:Drosophila_2:1636910_at:340:97; Interrogation_Position=230; Antisense; AGATACTTCACTGGCCTTGCTATTC
>probe:Drosophila_2:1636910_at:186:65; Interrogation_Position=259; Antisense; ATGGGCTCTCATCGTTTGTGTAGCG
>probe:Drosophila_2:1636910_at:68:623; Interrogation_Position=294; Antisense; TGCTGATTGGTGGAGCCCTCTACTT
>probe:Drosophila_2:1636910_at:302:687; Interrogation_Position=449; Antisense; TATACTCCTGCCCAGACTCATGAGA
>probe:Drosophila_2:1636910_at:562:57; Interrogation_Position=468; Antisense; ATGAGACGGCCAATGTGACTCCCAC
>probe:Drosophila_2:1636910_at:516:49; Interrogation_Position=501; Antisense; ATGCCACCGCTATTGTCTGAGGAGA
>probe:Drosophila_2:1636910_at:470:541; Interrogation_Position=553; Antisense; GGTTCATAACCCTTTCCAAATCAGT
>probe:Drosophila_2:1636910_at:583:159; Interrogation_Position=624; Antisense; AAATAGAACCTGTGCCCTTTGTCTA
>probe:Drosophila_2:1636910_at:229:305; Interrogation_Position=639; Antisense; CCTTTGTCTACCTTCATTTTCGAAT
>probe:Drosophila_2:1636910_at:179:689; Interrogation_Position=669; Antisense; TATTTGCCACTTATCTGGCGCCAAA

Paste this into a BLAST search page for me
TTGGCTAAGAAGTGCTCCACCTACTCACCTACTTGGTGATATGCCTGGTAATATGCCTGGTACTGTTGGCCTGCTGCAAGAATCGGAGGCCACGCGACGTAGATACTTCACTGGCCTTGCTATTCATGGGCTCTCATCGTTTGTGTAGCGTGCTGATTGGTGGAGCCCTCTACTTTATACTCCTGCCCAGACTCATGAGAATGAGACGGCCAATGTGACTCCCACATGCCACCGCTATTGTCTGAGGAGAGGTTCATAACCCTTTCCAAATCAGTAAATAGAACCTGTGCCCTTTGTCTACCTTTGTCTACCTTCATTTTCGAATTATTTGCCACTTATCTGGCGCCAAA

Full Affymetrix probeset data:

Annotations for 1636910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720