Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636911_at:

>probe:Drosophila_2:1636911_at:129:297; Interrogation_Position=5691; Antisense; GCATACGTTTAACCCAAATATGTCC
>probe:Drosophila_2:1636911_at:340:243; Interrogation_Position=5707; Antisense; AATATGTCCACACTTTTGCACACAC
>probe:Drosophila_2:1636911_at:564:681; Interrogation_Position=5709; Antisense; TATGTCCACACTTTTGCACACACAA
>probe:Drosophila_2:1636911_at:716:597; Interrogation_Position=5711; Antisense; TGTCCACACTTTTGCACACACAAGG
>probe:Drosophila_2:1636911_at:217:309; Interrogation_Position=5714; Antisense; CCACACTTTTGCACACACAAGGCAG
>probe:Drosophila_2:1636911_at:144:149; Interrogation_Position=5718; Antisense; ACTTTTGCACACACAAGGCAGACAA
>probe:Drosophila_2:1636911_at:341:693; Interrogation_Position=5721; Antisense; TTTGCACACACAAGGCAGACAAAAG
>probe:Drosophila_2:1636911_at:420:157; Interrogation_Position=5730; Antisense; ACAAGGCAGACAAAAGAAATCAGCT
>probe:Drosophila_2:1636911_at:220:107; Interrogation_Position=5744; Antisense; AGAAATCAGCTGGAACATCTTGTTT
>probe:Drosophila_2:1636911_at:650:239; Interrogation_Position=5747; Antisense; AATCAGCTGGAACATCTTGTTTATC
>probe:Drosophila_2:1636911_at:461:261; Interrogation_Position=5750; Antisense; CAGCTGGAACATCTTGTTTATCAAG
>probe:Drosophila_2:1636911_at:300:385; Interrogation_Position=5756; Antisense; GAACATCTTGTTTATCAAGCAGGCA
>probe:Drosophila_2:1636911_at:506:273; Interrogation_Position=5762; Antisense; CTTGTTTATCAAGCAGGCAAATTCG
>probe:Drosophila_2:1636911_at:122:685; Interrogation_Position=5768; Antisense; TATCAAGCAGGCAAATTCGAATGTG

Paste this into a BLAST search page for me
GCATACGTTTAACCCAAATATGTCCAATATGTCCACACTTTTGCACACACTATGTCCACACTTTTGCACACACAATGTCCACACTTTTGCACACACAAGGCCACACTTTTGCACACACAAGGCAGACTTTTGCACACACAAGGCAGACAATTTGCACACACAAGGCAGACAAAAGACAAGGCAGACAAAAGAAATCAGCTAGAAATCAGCTGGAACATCTTGTTTAATCAGCTGGAACATCTTGTTTATCCAGCTGGAACATCTTGTTTATCAAGGAACATCTTGTTTATCAAGCAGGCACTTGTTTATCAAGCAGGCAAATTCGTATCAAGCAGGCAAATTCGAATGTG

Full Affymetrix probeset data:

Annotations for 1636911_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime