FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636912_at:

>probe:Drosophila_2:1636912_at:228:155; Interrogation_Position=1344; Antisense; ACAGCACCAGAACATGTTTCCGTCA
>probe:Drosophila_2:1636912_at:37:557; Interrogation_Position=1374; Antisense; GGACTTCCTTTTCCAGTTATACCAG
>probe:Drosophila_2:1636912_at:431:703; Interrogation_Position=1390; Antisense; TTATACCAGCAGTTCCCACATCAGG
>probe:Drosophila_2:1636912_at:127:717; Interrogation_Position=1422; Antisense; TTCGCATCCCGCAAACTTCGGGAAA
>probe:Drosophila_2:1636912_at:402:239; Interrogation_Position=1462; Antisense; AATCATCCGGGTGTGCAGCGGTTGT
>probe:Drosophila_2:1636912_at:604:617; Interrogation_Position=1475; Antisense; TGCAGCGGTTGTCTGAGCATTTGCT
>probe:Drosophila_2:1636912_at:521:363; Interrogation_Position=1504; Antisense; GAATTAGTCACCACGGAACTGCTGA
>probe:Drosophila_2:1636912_at:708:715; Interrogation_Position=1585; Antisense; TTCGACGATTAAAGGGCTAGCTACT
>probe:Drosophila_2:1636912_at:730:23; Interrogation_Position=1676; Antisense; ATAGTAATTGCATCGCTTTGGTCAA
>probe:Drosophila_2:1636912_at:594:537; Interrogation_Position=1695; Antisense; GGTCAAATTTCCCACCAATGAGTCA
>probe:Drosophila_2:1636912_at:4:693; Interrogation_Position=1720; Antisense; TTTGCAAAGCTCTACGTTCTACCGA
>probe:Drosophila_2:1636912_at:539:403; Interrogation_Position=1735; Antisense; GTTCTACCGAACACTTTTCAAATGT
>probe:Drosophila_2:1636912_at:201:697; Interrogation_Position=1750; Antisense; TTTCAAATGTGCTAGTCAAGACCAG
>probe:Drosophila_2:1636912_at:299:3; Interrogation_Position=1777; Antisense; ATTGGGATTCCATATCTGCATTAAT

Paste this into a BLAST search page for me
ACAGCACCAGAACATGTTTCCGTCAGGACTTCCTTTTCCAGTTATACCAGTTATACCAGCAGTTCCCACATCAGGTTCGCATCCCGCAAACTTCGGGAAAAATCATCCGGGTGTGCAGCGGTTGTTGCAGCGGTTGTCTGAGCATTTGCTGAATTAGTCACCACGGAACTGCTGATTCGACGATTAAAGGGCTAGCTACTATAGTAATTGCATCGCTTTGGTCAAGGTCAAATTTCCCACCAATGAGTCATTTGCAAAGCTCTACGTTCTACCGAGTTCTACCGAACACTTTTCAAATGTTTTCAAATGTGCTAGTCAAGACCAGATTGGGATTCCATATCTGCATTAAT

Full Affymetrix probeset data:

Annotations for 1636912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720