FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636914_at:

>probe:Drosophila_2:1636914_at:680:449; Interrogation_Position=1252; Antisense; GATCGCAGCCTTTTGCTCCAAGGAT
>probe:Drosophila_2:1636914_at:637:347; Interrogation_Position=1278; Antisense; GCAGGACGTGGCGTTCATAAACCCA
>probe:Drosophila_2:1636914_at:17:301; Interrogation_Position=1299; Antisense; CCCAGCCAATGTGGTGTTTGTCTAC
>probe:Drosophila_2:1636914_at:126:481; Interrogation_Position=1314; Antisense; GTTTGTCTACATGCTAGTCCGCGAG
>probe:Drosophila_2:1636914_at:338:73; Interrogation_Position=1361; Antisense; AGGAATCGGATCTTCAGGCATCAGT
>probe:Drosophila_2:1636914_at:188:73; Interrogation_Position=1376; Antisense; AGGCATCAGTACTCACCTGTTTGTA
>probe:Drosophila_2:1636914_at:228:305; Interrogation_Position=1391; Antisense; CCTGTTTGTATCTGTCTTATTCGTA
>probe:Drosophila_2:1636914_at:393:647; Interrogation_Position=1430; Antisense; TCAGTTATCCACTCAAACCGTTTTT
>probe:Drosophila_2:1636914_at:152:155; Interrogation_Position=1484; Antisense; ACAGGTGCCTCGTCATTGTGAACAA
>probe:Drosophila_2:1636914_at:68:53; Interrogation_Position=1535; Antisense; ATGCTGAGCCGGGATTTTTTACCGA
>probe:Drosophila_2:1636914_at:510:671; Interrogation_Position=1554; Antisense; TACCGAAGTCTTTACTGAGCTGAAA
>probe:Drosophila_2:1636914_at:450:239; Interrogation_Position=1607; Antisense; AATCATACTGTGGAGGCGCCTGACG
>probe:Drosophila_2:1636914_at:76:703; Interrogation_Position=1649; Antisense; TTATTGTCAACCTCTCATTGTCTGC
>probe:Drosophila_2:1636914_at:515:623; Interrogation_Position=1671; Antisense; TGCGCATCGCCAGAAATTTCCGGAT

Paste this into a BLAST search page for me
GATCGCAGCCTTTTGCTCCAAGGATGCAGGACGTGGCGTTCATAAACCCACCCAGCCAATGTGGTGTTTGTCTACGTTTGTCTACATGCTAGTCCGCGAGAGGAATCGGATCTTCAGGCATCAGTAGGCATCAGTACTCACCTGTTTGTACCTGTTTGTATCTGTCTTATTCGTATCAGTTATCCACTCAAACCGTTTTTACAGGTGCCTCGTCATTGTGAACAAATGCTGAGCCGGGATTTTTTACCGATACCGAAGTCTTTACTGAGCTGAAAAATCATACTGTGGAGGCGCCTGACGTTATTGTCAACCTCTCATTGTCTGCTGCGCATCGCCAGAAATTTCCGGAT

Full Affymetrix probeset data:

Annotations for 1636914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720