FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636916_at:

>probe:Drosophila_2:1636916_at:7:15; Interrogation_Position=102; Antisense; ATTACGACCATTCTGGCCGACTGAA
>probe:Drosophila_2:1636916_at:346:179; Interrogation_Position=198; Antisense; AAACATCACGTCTGATCGGCAGCGA
>probe:Drosophila_2:1636916_at:647:293; Interrogation_Position=231; Antisense; CGAGGTTCCAAGTAGCGCCAGAGCA
>probe:Drosophila_2:1636916_at:183:5; Interrogation_Position=276; Antisense; ATTCGATTTCGGAACTCGGACTCGG
>probe:Drosophila_2:1636916_at:277:639; Interrogation_Position=291; Antisense; TCGGACTCGGGATCTATTCGGTTCG
>probe:Drosophila_2:1636916_at:690:689; Interrogation_Position=305; Antisense; TATTCGGTTCGGCTCAGATTGGATC
>probe:Drosophila_2:1636916_at:482:637; Interrogation_Position=368; Antisense; TCGTATCGAAGATCGCCAGTCTGGT
>probe:Drosophila_2:1636916_at:6:309; Interrogation_Position=383; Antisense; CCAGTCTGGTGGAGTCTTCAGTCTG
>probe:Drosophila_2:1636916_at:640:275; Interrogation_Position=398; Antisense; CTTCAGTCTGGCTCTTGTGTGGTGG
>probe:Drosophila_2:1636916_at:624:525; Interrogation_Position=472; Antisense; GGGACTTCAAGTGGCCGTAGACGAC
>probe:Drosophila_2:1636916_at:578:375; Interrogation_Position=502; Antisense; GAAGAGCGTCTTCTGCACACACTAT
>probe:Drosophila_2:1636916_at:520:685; Interrogation_Position=524; Antisense; TATCACATTGTCATGTCACGCCGGG
>probe:Drosophila_2:1636916_at:449:291; Interrogation_Position=545; Antisense; CGGGCTCTCCACTAAACGATATTAT
>probe:Drosophila_2:1636916_at:486:361; Interrogation_Position=63; Antisense; GAAGTCGGTCCACGGCCACAAAAAG

Paste this into a BLAST search page for me
ATTACGACCATTCTGGCCGACTGAAAAACATCACGTCTGATCGGCAGCGACGAGGTTCCAAGTAGCGCCAGAGCAATTCGATTTCGGAACTCGGACTCGGTCGGACTCGGGATCTATTCGGTTCGTATTCGGTTCGGCTCAGATTGGATCTCGTATCGAAGATCGCCAGTCTGGTCCAGTCTGGTGGAGTCTTCAGTCTGCTTCAGTCTGGCTCTTGTGTGGTGGGGGACTTCAAGTGGCCGTAGACGACGAAGAGCGTCTTCTGCACACACTATTATCACATTGTCATGTCACGCCGGGCGGGCTCTCCACTAAACGATATTATGAAGTCGGTCCACGGCCACAAAAAG

Full Affymetrix probeset data:

Annotations for 1636916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720