FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636919_at:

>probe:Drosophila_2:1636919_at:412:83; Interrogation_Position=1025; Antisense; AGTACAAGCAGTAACTTAGCCTAAG
>probe:Drosophila_2:1636919_at:584:161; Interrogation_Position=1081; Antisense; AAATACGCACTCACATACGGTTTTG
>probe:Drosophila_2:1636919_at:619:219; Interrogation_Position=518; Antisense; AAGTGCCTGGTCTTCTCACTCATCG
>probe:Drosophila_2:1636919_at:456:647; Interrogation_Position=537; Antisense; TCATCGGCCTGCATTTCAAGATCAA
>probe:Drosophila_2:1636919_at:542:453; Interrogation_Position=556; Antisense; GATCAAGCCCATATAAGCCGTAGCC
>probe:Drosophila_2:1636919_at:237:129; Interrogation_Position=581; Antisense; ACCACCTCAAGCATAGCCTATTTAT
>probe:Drosophila_2:1636919_at:6:27; Interrogation_Position=593; Antisense; ATAGCCTATTTATCGGACGGACACA
>probe:Drosophila_2:1636919_at:245:639; Interrogation_Position=605; Antisense; TCGGACGGACACATCGTATTTTATA
>probe:Drosophila_2:1636919_at:523:227; Interrogation_Position=629; Antisense; AATGGAACTTCTACGATACTTGTAA
>probe:Drosophila_2:1636919_at:191:655; Interrogation_Position=659; Antisense; TAAGCTATACCTTTGTACTTTTTGG
>probe:Drosophila_2:1636919_at:307:277; Interrogation_Position=676; Antisense; CTTTTTGGTACAGTTTGCAGTGAAT
>probe:Drosophila_2:1636919_at:84:257; Interrogation_Position=729; Antisense; CAAAGTCTTGTGTACAGTCTAGATT
>probe:Drosophila_2:1636919_at:432:357; Interrogation_Position=772; Antisense; GCAAATCTTCGATGTAGTAGCAGAC
>probe:Drosophila_2:1636919_at:121:463; Interrogation_Position=985; Antisense; GATTAATATCTCACAAACTGGCAAA

Paste this into a BLAST search page for me
AGTACAAGCAGTAACTTAGCCTAAGAAATACGCACTCACATACGGTTTTGAAGTGCCTGGTCTTCTCACTCATCGTCATCGGCCTGCATTTCAAGATCAAGATCAAGCCCATATAAGCCGTAGCCACCACCTCAAGCATAGCCTATTTATATAGCCTATTTATCGGACGGACACATCGGACGGACACATCGTATTTTATAAATGGAACTTCTACGATACTTGTAATAAGCTATACCTTTGTACTTTTTGGCTTTTTGGTACAGTTTGCAGTGAATCAAAGTCTTGTGTACAGTCTAGATTGCAAATCTTCGATGTAGTAGCAGACGATTAATATCTCACAAACTGGCAAA

Full Affymetrix probeset data:

Annotations for 1636919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720