FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636921_at:

>probe:Drosophila_2:1636921_at:468:133; Interrogation_Position=1172; Antisense; CCGCGGAAACGCTCTTTCAACAGTA
>probe:Drosophila_2:1636921_at:705:91; Interrogation_Position=652; Antisense; AGTTGAGCAAGGATGTGCCGCCCAA
>probe:Drosophila_2:1636921_at:485:597; Interrogation_Position=665; Antisense; TGTGCCGCCCAAGGATTGAGCGGAT
>probe:Drosophila_2:1636921_at:30:545; Interrogation_Position=686; Antisense; GGATATAGATCCAAAGACTGCTGAA
>probe:Drosophila_2:1636921_at:81:335; Interrogation_Position=705; Antisense; GCTGAAAGTATTTTATACGACCCCG
>probe:Drosophila_2:1636921_at:147:167; Interrogation_Position=735; Antisense; AAATCCGTTCACCTGAAAATCTGGT
>probe:Drosophila_2:1636921_at:652:39; Interrogation_Position=753; Antisense; ATCTGGTTCCACTTAAGCTGAAGGC
>probe:Drosophila_2:1636921_at:392:615; Interrogation_Position=771; Antisense; TGAAGGCATCAGTTGCTCAAGCAAT
>probe:Drosophila_2:1636921_at:646:107; Interrogation_Position=790; Antisense; AGCAATGGATGTAACCTAGGTTCTA
>probe:Drosophila_2:1636921_at:314:493; Interrogation_Position=824; Antisense; GTAATCGTAGCTAAAGCCATCCCGA
>probe:Drosophila_2:1636921_at:152:315; Interrogation_Position=839; Antisense; GCCATCCCGATTTGATTGGAACTGT
>probe:Drosophila_2:1636921_at:633:675; Interrogation_Position=882; Antisense; TAGATTTTCTAACTACTCCAACGTA
>probe:Drosophila_2:1636921_at:4:223; Interrogation_Position=907; Antisense; AAGTGGCTAATGATGCTCTTTCAAT
>probe:Drosophila_2:1636921_at:567:203; Interrogation_Position=996; Antisense; AACCAATCAAAATCCTGTCTTACAG

Paste this into a BLAST search page for me
CCGCGGAAACGCTCTTTCAACAGTAAGTTGAGCAAGGATGTGCCGCCCAATGTGCCGCCCAAGGATTGAGCGGATGGATATAGATCCAAAGACTGCTGAAGCTGAAAGTATTTTATACGACCCCGAAATCCGTTCACCTGAAAATCTGGTATCTGGTTCCACTTAAGCTGAAGGCTGAAGGCATCAGTTGCTCAAGCAATAGCAATGGATGTAACCTAGGTTCTAGTAATCGTAGCTAAAGCCATCCCGAGCCATCCCGATTTGATTGGAACTGTTAGATTTTCTAACTACTCCAACGTAAAGTGGCTAATGATGCTCTTTCAATAACCAATCAAAATCCTGTCTTACAG

Full Affymetrix probeset data:

Annotations for 1636921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720