FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636922_at:

>probe:Drosophila_2:1636922_at:164:497; Interrogation_Position=1066; Antisense; GTCATCACGGAACGATTTGGCTCAA
>probe:Drosophila_2:1636922_at:57:227; Interrogation_Position=1090; Antisense; AAGGCAGCCCGAATATTTCGAGTGA
>probe:Drosophila_2:1636922_at:706:547; Interrogation_Position=1155; Antisense; GGAGGCCATGATCCCATCCAAAGAG
>probe:Drosophila_2:1636922_at:671:217; Interrogation_Position=1183; Antisense; AAGTCGCTGGCGTATAATTTGTTCC
>probe:Drosophila_2:1636922_at:56:493; Interrogation_Position=1256; Antisense; GTAATGGCCCCGCAAAGGCATTTTA
>probe:Drosophila_2:1636922_at:131:69; Interrogation_Position=1271; Antisense; AGGCATTTTACCTCTTCCAGGTCAA
>probe:Drosophila_2:1636922_at:9:97; Interrogation_Position=1302; Antisense; AGATACCGTGAGAATGCTGCTTGAT
>probe:Drosophila_2:1636922_at:390:49; Interrogation_Position=1325; Antisense; ATGCCAGCTACAAATCCCTTTATAA
>probe:Drosophila_2:1636922_at:16:573; Interrogation_Position=1412; Antisense; GGCTGGACAGCATCGTAGAGGCCAT
>probe:Drosophila_2:1636922_at:514:95; Interrogation_Position=1472; Antisense; AGATTGTTGAGACTTTCACGCCGCC
>probe:Drosophila_2:1636922_at:25:303; Interrogation_Position=1492; Antisense; CCGCCGGAATGCGAGATCCTTAATA
>probe:Drosophila_2:1636922_at:681:173; Interrogation_Position=1546; Antisense; AAAGCTGAACTGACCCTAGACGATA
>probe:Drosophila_2:1636922_at:402:409; Interrogation_Position=1564; Antisense; GACGATACAATCTTTCTTCTGCAAA
>probe:Drosophila_2:1636922_at:392:7; Interrogation_Position=1601; Antisense; ATTGCACTACGCTGCCAACGGGTAT

Paste this into a BLAST search page for me
GTCATCACGGAACGATTTGGCTCAAAAGGCAGCCCGAATATTTCGAGTGAGGAGGCCATGATCCCATCCAAAGAGAAGTCGCTGGCGTATAATTTGTTCCGTAATGGCCCCGCAAAGGCATTTTAAGGCATTTTACCTCTTCCAGGTCAAAGATACCGTGAGAATGCTGCTTGATATGCCAGCTACAAATCCCTTTATAAGGCTGGACAGCATCGTAGAGGCCATAGATTGTTGAGACTTTCACGCCGCCCCGCCGGAATGCGAGATCCTTAATAAAAGCTGAACTGACCCTAGACGATAGACGATACAATCTTTCTTCTGCAAAATTGCACTACGCTGCCAACGGGTAT

Full Affymetrix probeset data:

Annotations for 1636922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720