FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636927_at:

>probe:Drosophila_2:1636927_at:387:675; Interrogation_Position=260; Antisense; TAGCAATATTTTCTTACCACCAACC
>probe:Drosophila_2:1636927_at:416:201; Interrogation_Position=281; Antisense; AACCCACCAAGGACTTCATGCATGA
>probe:Drosophila_2:1636927_at:343:473; Interrogation_Position=319; Antisense; GTTCTTGTCGCCATGATCGTTAACA
>probe:Drosophila_2:1636927_at:579:371; Interrogation_Position=386; Antisense; GAAGGCATCCTGTTAACCTGATTTG
>probe:Drosophila_2:1636927_at:81:605; Interrogation_Position=404; Antisense; TGATTTGCCTCGCTCTTTATACCTT
>probe:Drosophila_2:1636927_at:381:9; Interrogation_Position=470; Antisense; ATTCCAATGTGGTAATCTCGGCCGT
>probe:Drosophila_2:1636927_at:98:581; Interrogation_Position=494; Antisense; TGGCCATTACCACACTTCTAGTCAT
>probe:Drosophila_2:1636927_at:665:163; Interrogation_Position=547; Antisense; AAATACGATTACACAGCTGCTGGAG
>probe:Drosophila_2:1636927_at:693:447; Interrogation_Position=627; Antisense; GATGCCCGATTTCGTAGACAGCCTG
>probe:Drosophila_2:1636927_at:435:31; Interrogation_Position=655; Antisense; ATAACTTGCCTATGCACCTTTATTG
>probe:Drosophila_2:1636927_at:627:25; Interrogation_Position=712; Antisense; ATAGTGGGCGGCAATCGTTCGGAAC
>probe:Drosophila_2:1636927_at:372:565; Interrogation_Position=750; Antisense; GGAATATGTATTCGCGGCTCTCACT
>probe:Drosophila_2:1636927_at:160:147; Interrogation_Position=772; Antisense; ACTCTGTACGTCGATGTGGTTCGCA
>probe:Drosophila_2:1636927_at:298:541; Interrogation_Position=789; Antisense; GGTTCGCATATTCATTTACATCCTT

Paste this into a BLAST search page for me
TAGCAATATTTTCTTACCACCAACCAACCCACCAAGGACTTCATGCATGAGTTCTTGTCGCCATGATCGTTAACAGAAGGCATCCTGTTAACCTGATTTGTGATTTGCCTCGCTCTTTATACCTTATTCCAATGTGGTAATCTCGGCCGTTGGCCATTACCACACTTCTAGTCATAAATACGATTACACAGCTGCTGGAGGATGCCCGATTTCGTAGACAGCCTGATAACTTGCCTATGCACCTTTATTGATAGTGGGCGGCAATCGTTCGGAACGGAATATGTATTCGCGGCTCTCACTACTCTGTACGTCGATGTGGTTCGCAGGTTCGCATATTCATTTACATCCTT

Full Affymetrix probeset data:

Annotations for 1636927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720