FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636929_at:

>probe:Drosophila_2:1636929_at:612:181; Interrogation_Position=122; Antisense; AAAACTACGCGACCGAAGGCAGTGT
>probe:Drosophila_2:1636929_at:9:227; Interrogation_Position=137; Antisense; AAGGCAGTGTACCTGTGGACAGTTA
>probe:Drosophila_2:1636929_at:258:259; Interrogation_Position=15; Antisense; CACTATTTGTTTTGTTGCTATTTGC
>probe:Drosophila_2:1636929_at:121:313; Interrogation_Position=186; Antisense; GCCACTGCGGTGAATACACCCAGTA
>probe:Drosophila_2:1636929_at:42:31; Interrogation_Position=199; Antisense; ATACACCCAGTATGAGCAGCTCTTC
>probe:Drosophila_2:1636929_at:351:719; Interrogation_Position=221; Antisense; TTCGCCCAGCACGATATAACCGGAA
>probe:Drosophila_2:1636929_at:275:457; Interrogation_Position=233; Antisense; GATATAACCGGAAGGGCTCTACTCC
>probe:Drosophila_2:1636929_at:127:35; Interrogation_Position=260; Antisense; ATCACAGACTCCTCACTGCAAAGAA
>probe:Drosophila_2:1636929_at:506:169; Interrogation_Position=279; Antisense; AAAGAATGGGCGTGACGGACAACCG
>probe:Drosophila_2:1636929_at:472:471; Interrogation_Position=295; Antisense; GGACAACCGGGATCGGGAAGCCATT
>probe:Drosophila_2:1636929_at:59:315; Interrogation_Position=314; Antisense; GCCATTTGGCGGGAGATCGTTAAGC
>probe:Drosophila_2:1636929_at:563:221; Interrogation_Position=379; Antisense; AAGGCTCAATATTTACTAGGGTCAC
>probe:Drosophila_2:1636929_at:662:137; Interrogation_Position=402; Antisense; ACGATATACTCGTTTTATTTGCTGT
>probe:Drosophila_2:1636929_at:542:11; Interrogation_Position=472; Antisense; ATTCTTAGACGCCATATCTGGTTTT

Paste this into a BLAST search page for me
AAAACTACGCGACCGAAGGCAGTGTAAGGCAGTGTACCTGTGGACAGTTACACTATTTGTTTTGTTGCTATTTGCGCCACTGCGGTGAATACACCCAGTAATACACCCAGTATGAGCAGCTCTTCTTCGCCCAGCACGATATAACCGGAAGATATAACCGGAAGGGCTCTACTCCATCACAGACTCCTCACTGCAAAGAAAAAGAATGGGCGTGACGGACAACCGGGACAACCGGGATCGGGAAGCCATTGCCATTTGGCGGGAGATCGTTAAGCAAGGCTCAATATTTACTAGGGTCACACGATATACTCGTTTTATTTGCTGTATTCTTAGACGCCATATCTGGTTTT

Full Affymetrix probeset data:

Annotations for 1636929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720