FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636930_at:

>probe:Drosophila_2:1636930_at:664:321; Interrogation_Position=1233; Antisense; GCCCAGCGCTCGTAATGATTTCTAT
>probe:Drosophila_2:1636930_at:351:605; Interrogation_Position=1248; Antisense; TGATTTCTATGACTCGTGTGCTCCG
>probe:Drosophila_2:1636930_at:551:337; Interrogation_Position=1267; Antisense; GCTCCGACAATCGTTTGTGGCCTGA
>probe:Drosophila_2:1636930_at:662:521; Interrogation_Position=1283; Antisense; GTGGCCTGATTTATTGTCACACTCC
>probe:Drosophila_2:1636930_at:607:237; Interrogation_Position=1372; Antisense; AATCTGGCGCAGATTTGCCGGGAAC
>probe:Drosophila_2:1636930_at:211:609; Interrogation_Position=1407; Antisense; TGAGCTCAGATCGAATTGCACACCA
>probe:Drosophila_2:1636930_at:539:187; Interrogation_Position=1431; Antisense; AACACGATTGGCCTTTGCCAGGTTG
>probe:Drosophila_2:1636930_at:8:469; Interrogation_Position=1452; Antisense; GTTGCTATGCAACGCTGGCTTTCAG
>probe:Drosophila_2:1636930_at:202:395; Interrogation_Position=1540; Antisense; GAAATGTGTTTGCTTGGCACCCAGC
>probe:Drosophila_2:1636930_at:606:431; Interrogation_Position=1605; Antisense; GAGTCTCCTGAGATGCCTGCAAACG
>probe:Drosophila_2:1636930_at:527:393; Interrogation_Position=1645; Antisense; GAAAGGTATCTTCCCACTCAGGAGC
>probe:Drosophila_2:1636930_at:404:5; Interrogation_Position=1687; Antisense; ATTGTGGATGAGTTCGCCATACCCG
>probe:Drosophila_2:1636930_at:403:473; Interrogation_Position=1724; Antisense; GTTACCTCAGCGACTTTGACGAACT
>probe:Drosophila_2:1636930_at:187:415; Interrogation_Position=1768; Antisense; GAGCCGGTCGATATACCTGTTGTTA

Paste this into a BLAST search page for me
GCCCAGCGCTCGTAATGATTTCTATTGATTTCTATGACTCGTGTGCTCCGGCTCCGACAATCGTTTGTGGCCTGAGTGGCCTGATTTATTGTCACACTCCAATCTGGCGCAGATTTGCCGGGAACTGAGCTCAGATCGAATTGCACACCAAACACGATTGGCCTTTGCCAGGTTGGTTGCTATGCAACGCTGGCTTTCAGGAAATGTGTTTGCTTGGCACCCAGCGAGTCTCCTGAGATGCCTGCAAACGGAAAGGTATCTTCCCACTCAGGAGCATTGTGGATGAGTTCGCCATACCCGGTTACCTCAGCGACTTTGACGAACTGAGCCGGTCGATATACCTGTTGTTA

Full Affymetrix probeset data:

Annotations for 1636930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720