Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636931_at:

>probe:Drosophila_2:1636931_at:616:629; Interrogation_Position=2515; Antisense; TCCTACCTCAATTCCGATGGCAGAT
>probe:Drosophila_2:1636931_at:164:545; Interrogation_Position=2545; Antisense; GGATCTAGCCATCTACCCAAAGCGA
>probe:Drosophila_2:1636931_at:264:415; Interrogation_Position=2568; Antisense; GACCAATGCCGCTGAATGACCAGTA
>probe:Drosophila_2:1636931_at:538:29; Interrogation_Position=2618; Antisense; ATAATGACCCTGTACGACTACTACC
>probe:Drosophila_2:1636931_at:389:147; Interrogation_Position=2634; Antisense; ACTACTACCTCTACCAGCGTAATAG
>probe:Drosophila_2:1636931_at:350:495; Interrogation_Position=2670; Antisense; GTCACAGTCACAGTCGCAATCACGG
>probe:Drosophila_2:1636931_at:239:35; Interrogation_Position=2688; Antisense; ATCACGGTCAAAGTCACAGCAGCAG
>probe:Drosophila_2:1636931_at:398:155; Interrogation_Position=2703; Antisense; ACAGCAGCAGTCACGGTCCTTCAAT
>probe:Drosophila_2:1636931_at:504:709; Interrogation_Position=2722; Antisense; TTCAATTGCCACCACGAGCAACTAG
>probe:Drosophila_2:1636931_at:111:677; Interrogation_Position=2846; Antisense; TAGGCCCCATCTTTATTATTACGAG
>probe:Drosophila_2:1636931_at:292:237; Interrogation_Position=2989; Antisense; AATCTATACATCGACTTGCTGACTT
>probe:Drosophila_2:1636931_at:568:723; Interrogation_Position=3004; Antisense; TTGCTGACTTTTTCACAACTCACGC
>probe:Drosophila_2:1636931_at:672:253; Interrogation_Position=3019; Antisense; CAACTCACGCCTATGGACCAGTATA
>probe:Drosophila_2:1636931_at:644:29; Interrogation_Position=3056; Antisense; ATACACTGTTTACACTCTGTGGCCT

Paste this into a BLAST search page for me
TCCTACCTCAATTCCGATGGCAGATGGATCTAGCCATCTACCCAAAGCGAGACCAATGCCGCTGAATGACCAGTAATAATGACCCTGTACGACTACTACCACTACTACCTCTACCAGCGTAATAGGTCACAGTCACAGTCGCAATCACGGATCACGGTCAAAGTCACAGCAGCAGACAGCAGCAGTCACGGTCCTTCAATTTCAATTGCCACCACGAGCAACTAGTAGGCCCCATCTTTATTATTACGAGAATCTATACATCGACTTGCTGACTTTTGCTGACTTTTTCACAACTCACGCCAACTCACGCCTATGGACCAGTATAATACACTGTTTACACTCTGTGGCCT

Full Affymetrix probeset data:

Annotations for 1636931_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime