Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636932_at:

>probe:Drosophila_2:1636932_at:580:191; Interrogation_Position=1469; Antisense; AACTTTTACAAGAATCTCGCGCAGG
>probe:Drosophila_2:1636932_at:590:615; Interrogation_Position=1506; Antisense; TGCTCACTGGACACACGGGTACCAA
>probe:Drosophila_2:1636932_at:333:597; Interrogation_Position=1531; Antisense; TGTGATGGATCTGCATTTCCTGGTC
>probe:Drosophila_2:1636932_at:370:19; Interrogation_Position=1545; Antisense; ATTTCCTGGTCGTGCCGTAGTGTAA
>probe:Drosophila_2:1636932_at:504:635; Interrogation_Position=1575; Antisense; TCGCTCGCCGATAAATCCATTTAGT
>probe:Drosophila_2:1636932_at:348:229; Interrogation_Position=1646; Antisense; AATGGAGCTGCTCTTGAACCGCAGA
>probe:Drosophila_2:1636932_at:124:301; Interrogation_Position=1664; Antisense; CCGCAGACGGGCAATAGTCGTTTAA
>probe:Drosophila_2:1636932_at:241:595; Interrogation_Position=1786; Antisense; TGTGATCTTTATGCTCTGAGACGGT
>probe:Drosophila_2:1636932_at:186:425; Interrogation_Position=1803; Antisense; GAGACGGTCTTCAGTGACAGCATAA
>probe:Drosophila_2:1636932_at:314:565; Interrogation_Position=1831; Antisense; GGCAATTAGCTTTCGTCTCCGGTTA
>probe:Drosophila_2:1636932_at:630:495; Interrogation_Position=1845; Antisense; GTCTCCGGTTATGAAATCAGCCTGG
>probe:Drosophila_2:1636932_at:8:263; Interrogation_Position=1862; Antisense; CAGCCTGGAATTGTCTTGATTGTAA
>probe:Drosophila_2:1636932_at:458:691; Interrogation_Position=1935; Antisense; TTTGTATATGCGATCACCACGGAGC
>probe:Drosophila_2:1636932_at:512:273; Interrogation_Position=1993; Antisense; CATTTCTTTTGTACTGCGTCTCATA

Paste this into a BLAST search page for me
AACTTTTACAAGAATCTCGCGCAGGTGCTCACTGGACACACGGGTACCAATGTGATGGATCTGCATTTCCTGGTCATTTCCTGGTCGTGCCGTAGTGTAATCGCTCGCCGATAAATCCATTTAGTAATGGAGCTGCTCTTGAACCGCAGACCGCAGACGGGCAATAGTCGTTTAATGTGATCTTTATGCTCTGAGACGGTGAGACGGTCTTCAGTGACAGCATAAGGCAATTAGCTTTCGTCTCCGGTTAGTCTCCGGTTATGAAATCAGCCTGGCAGCCTGGAATTGTCTTGATTGTAATTTGTATATGCGATCACCACGGAGCCATTTCTTTTGTACTGCGTCTCATA

Full Affymetrix probeset data:

Annotations for 1636932_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime