FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636933_at:

>probe:Drosophila_2:1636933_at:357:41; Interrogation_Position=387; Antisense; ATCGTCCATTATCCTAACACTGTTC
>probe:Drosophila_2:1636933_at:302:143; Interrogation_Position=405; Antisense; ACTGTTCAGGCAGGGATTCGATCCA
>probe:Drosophila_2:1636933_at:270:25; Interrogation_Position=440; Antisense; ATATGTTTGGCTTCAGCTTCGGCGG
>probe:Drosophila_2:1636933_at:532:343; Interrogation_Position=455; Antisense; GCTTCGGCGGACAACTGGCTTCGGC
>probe:Drosophila_2:1636933_at:570:579; Interrogation_Position=497; Antisense; GGCCACACCACATTATCGAGAGCAT
>probe:Drosophila_2:1636933_at:466:627; Interrogation_Position=574; Antisense; TCCAAGGCCGGCAAGCATGTGCAGT
>probe:Drosophila_2:1636933_at:180:359; Interrogation_Position=647; Antisense; GCAACATAATGCTCGGCAGCTGCGG
>probe:Drosophila_2:1636933_at:233:591; Interrogation_Position=717; Antisense; TGGTCTCTGCGTCGACATATACATC
>probe:Drosophila_2:1636933_at:216:667; Interrogation_Position=736; Antisense; TACATCAACACGTTCGACTATCCCT
>probe:Drosophila_2:1636933_at:36:551; Interrogation_Position=786; Antisense; GGAGTGCTTCACCTGGCAAAAGACG
>probe:Drosophila_2:1636933_at:638:27; Interrogation_Position=817; Antisense; ATACCAGATGGCTACACGGTGGGCT
>probe:Drosophila_2:1636933_at:342:665; Interrogation_Position=829; Antisense; TACACGGTGGGCTACGAGGAGAACT
>probe:Drosophila_2:1636933_at:251:421; Interrogation_Position=847; Antisense; GAGAACTTCGACAGCCAGGTCACGG
>probe:Drosophila_2:1636933_at:39:173; Interrogation_Position=930; Antisense; AAAGCTGCTGACCAAAGGCGGTGCT

Paste this into a BLAST search page for me
ATCGTCCATTATCCTAACACTGTTCACTGTTCAGGCAGGGATTCGATCCAATATGTTTGGCTTCAGCTTCGGCGGGCTTCGGCGGACAACTGGCTTCGGCGGCCACACCACATTATCGAGAGCATTCCAAGGCCGGCAAGCATGTGCAGTGCAACATAATGCTCGGCAGCTGCGGTGGTCTCTGCGTCGACATATACATCTACATCAACACGTTCGACTATCCCTGGAGTGCTTCACCTGGCAAAAGACGATACCAGATGGCTACACGGTGGGCTTACACGGTGGGCTACGAGGAGAACTGAGAACTTCGACAGCCAGGTCACGGAAAGCTGCTGACCAAAGGCGGTGCT

Full Affymetrix probeset data:

Annotations for 1636933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720