FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636934_at:

>probe:Drosophila_2:1636934_at:104:35; Interrogation_Position=134; Antisense; ATCAGCCCCTGGGTAATGGCGTCAA
>probe:Drosophila_2:1636934_at:358:661; Interrogation_Position=159; Antisense; TAAAACGCCTTTGCGCAAATCTGCG
>probe:Drosophila_2:1636934_at:678:61; Interrogation_Position=226; Antisense; ATGGGTTCGGCCACATCGACCATGT
>probe:Drosophila_2:1636934_at:410:631; Interrogation_Position=259; Antisense; TCCTCGACGCCACTGAGAAGTCATA
>probe:Drosophila_2:1636934_at:425:373; Interrogation_Position=275; Antisense; GAAGTCATAATCACTCCCAGTCGAG
>probe:Drosophila_2:1636934_at:515:399; Interrogation_Position=316; Antisense; GACACCATCAACACATTCCAGAAGT
>probe:Drosophila_2:1636934_at:403:145; Interrogation_Position=346; Antisense; ACTACGATCGAGTCCATCAGCTATG
>probe:Drosophila_2:1636934_at:429:63; Interrogation_Position=368; Antisense; ATGTGAGCACCAAGACCGTGTCCAT
>probe:Drosophila_2:1636934_at:111:499; Interrogation_Position=385; Antisense; GTGTCCATTTCGGATTTTACCCAGG
>probe:Drosophila_2:1636934_at:200:563; Interrogation_Position=408; Antisense; GGAACCGCAGCTACGTGAGCAAACA
>probe:Drosophila_2:1636934_at:21:613; Interrogation_Position=41; Antisense; TGACATTTCTTTCCGTGCACATTTC
>probe:Drosophila_2:1636934_at:463:255; Interrogation_Position=456; Antisense; CAAAATGGGCAGACGCGATCGCGAT
>probe:Drosophila_2:1636934_at:266:239; Interrogation_Position=490; Antisense; AATCTTGCAACCATTTGCCATGTCA
>probe:Drosophila_2:1636934_at:631:565; Interrogation_Position=76; Antisense; GGCACTCAAACGGATAGCCTGCTAA

Paste this into a BLAST search page for me
ATCAGCCCCTGGGTAATGGCGTCAATAAAACGCCTTTGCGCAAATCTGCGATGGGTTCGGCCACATCGACCATGTTCCTCGACGCCACTGAGAAGTCATAGAAGTCATAATCACTCCCAGTCGAGGACACCATCAACACATTCCAGAAGTACTACGATCGAGTCCATCAGCTATGATGTGAGCACCAAGACCGTGTCCATGTGTCCATTTCGGATTTTACCCAGGGGAACCGCAGCTACGTGAGCAAACATGACATTTCTTTCCGTGCACATTTCCAAAATGGGCAGACGCGATCGCGATAATCTTGCAACCATTTGCCATGTCAGGCACTCAAACGGATAGCCTGCTAA

Full Affymetrix probeset data:

Annotations for 1636934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720