FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636935_at:

>probe:Drosophila_2:1636935_at:485:231; Interrogation_Position=394; Antisense; AATGCGTACCGCTAAATGTCCTGAT
>probe:Drosophila_2:1636935_at:433:513; Interrogation_Position=426; Antisense; GTGTTCCCGTTCTGATACTAGCAAA
>probe:Drosophila_2:1636935_at:71:39; Interrogation_Position=459; Antisense; ATCTGCCCAACGCTTGTGGTGCAAT
>probe:Drosophila_2:1636935_at:155:535; Interrogation_Position=526; Antisense; GGTGCCTAATATATCAATGCCCTCT
>probe:Drosophila_2:1636935_at:30:297; Interrogation_Position=556; Antisense; CGACTCTTCTCCCACAATTAATTTA
>probe:Drosophila_2:1636935_at:1:427; Interrogation_Position=638; Antisense; GAGAGTCATCTGCATTCGTCTATGA
>probe:Drosophila_2:1636935_at:85:171; Interrogation_Position=689; Antisense; AAAGACCACAATTCCACGTTAAGCG
>probe:Drosophila_2:1636935_at:555:121; Interrogation_Position=710; Antisense; AGCGGAGGAGCCTTGACAGCTTTTA
>probe:Drosophila_2:1636935_at:444:399; Interrogation_Position=724; Antisense; GACAGCTTTTATATATCCGCAATCT
>probe:Drosophila_2:1636935_at:633:683; Interrogation_Position=737; Antisense; TATCCGCAATCTCACAACAATTCTG
>probe:Drosophila_2:1636935_at:14:187; Interrogation_Position=752; Antisense; AACAATTCTGCTGTACTGGATCAAA
>probe:Drosophila_2:1636935_at:630:79; Interrogation_Position=824; Antisense; AGGTCTTCATCAAATTCTGTGCAAT
>probe:Drosophila_2:1636935_at:440:127; Interrogation_Position=867; Antisense; AGCCAACCTGTGCTATAACTGGTGA
>probe:Drosophila_2:1636935_at:292:219; Interrogation_Position=903; Antisense; AAGGTTTGGACGCTCTGTATGATAT

Paste this into a BLAST search page for me
AATGCGTACCGCTAAATGTCCTGATGTGTTCCCGTTCTGATACTAGCAAAATCTGCCCAACGCTTGTGGTGCAATGGTGCCTAATATATCAATGCCCTCTCGACTCTTCTCCCACAATTAATTTAGAGAGTCATCTGCATTCGTCTATGAAAAGACCACAATTCCACGTTAAGCGAGCGGAGGAGCCTTGACAGCTTTTAGACAGCTTTTATATATCCGCAATCTTATCCGCAATCTCACAACAATTCTGAACAATTCTGCTGTACTGGATCAAAAGGTCTTCATCAAATTCTGTGCAATAGCCAACCTGTGCTATAACTGGTGAAAGGTTTGGACGCTCTGTATGATAT

Full Affymetrix probeset data:

Annotations for 1636935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720