FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636936_at:

>probe:Drosophila_2:1636936_at:652:257; Interrogation_Position=371; Antisense; CAGAGGATGTGGACGAACCGGAACC
>probe:Drosophila_2:1636936_at:498:533; Interrogation_Position=486; Antisense; GGTGCCCATTCAATTGGCGGCCATG
>probe:Drosophila_2:1636936_at:625:3; Interrogation_Position=498; Antisense; ATTGGCGGCCATGTGGCAACAGCCG
>probe:Drosophila_2:1636936_at:327:405; Interrogation_Position=545; Antisense; GACTGGGTCCTCTAAATCTGGGCGG
>probe:Drosophila_2:1636936_at:84:585; Interrogation_Position=585; Antisense; TGGCATTGCATTGAACACGCTCGGC
>probe:Drosophila_2:1636936_at:355:113; Interrogation_Position=681; Antisense; AGCAGCGTCACGTTCCGGAGTGGCA
>probe:Drosophila_2:1636936_at:635:437; Interrogation_Position=731; Antisense; GAGGACGTGCGTCCAATGCCCAGCA
>probe:Drosophila_2:1636936_at:3:353; Interrogation_Position=788; Antisense; GCAGCTTCACCTCGAACAACTATGT
>probe:Drosophila_2:1636936_at:59:65; Interrogation_Position=809; Antisense; ATGTGGCGCCCAGGCCGCGTTATTA
>probe:Drosophila_2:1636936_at:560:687; Interrogation_Position=829; Antisense; TATTATCGCGATACGGAGCCCATGC
>probe:Drosophila_2:1636936_at:282:51; Interrogation_Position=850; Antisense; ATGCGCGTCAACGTAATGGCACCAC
>probe:Drosophila_2:1636936_at:513:169; Interrogation_Position=893; Antisense; AAATGGCCAATATCCAGGGTCCCGT
>probe:Drosophila_2:1636936_at:139:243; Interrogation_Position=901; Antisense; AATATCCAGGGTCCCGTTCAGCTGG
>probe:Drosophila_2:1636936_at:416:333; Interrogation_Position=921; Antisense; GCTGGTGCCCGCCTACTGGCAATAG

Paste this into a BLAST search page for me
CAGAGGATGTGGACGAACCGGAACCGGTGCCCATTCAATTGGCGGCCATGATTGGCGGCCATGTGGCAACAGCCGGACTGGGTCCTCTAAATCTGGGCGGTGGCATTGCATTGAACACGCTCGGCAGCAGCGTCACGTTCCGGAGTGGCAGAGGACGTGCGTCCAATGCCCAGCAGCAGCTTCACCTCGAACAACTATGTATGTGGCGCCCAGGCCGCGTTATTATATTATCGCGATACGGAGCCCATGCATGCGCGTCAACGTAATGGCACCACAAATGGCCAATATCCAGGGTCCCGTAATATCCAGGGTCCCGTTCAGCTGGGCTGGTGCCCGCCTACTGGCAATAG

Full Affymetrix probeset data:

Annotations for 1636936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720