Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636939_at:

>probe:Drosophila_2:1636939_at:715:101; Interrogation_Position=2275; Antisense; AGAGACGGCTCACTTAGACTACCGC
>probe:Drosophila_2:1636939_at:267:99; Interrogation_Position=2290; Antisense; AGACTACCGCCTCGTAGTGGGTGAA
>probe:Drosophila_2:1636939_at:370:171; Interrogation_Position=2324; Antisense; AAAGTCGCTCAGGAGTTGGGTCCTC
>probe:Drosophila_2:1636939_at:481:591; Interrogation_Position=2340; Antisense; TGGGTCCTCTTTGCTTTCGATACAA
>probe:Drosophila_2:1636939_at:206:455; Interrogation_Position=2358; Antisense; GATACAAGGCTGTTCTTCTCAACTG
>probe:Drosophila_2:1636939_at:498:601; Interrogation_Position=2407; Antisense; TGTTCACGAATTCCGGATGTCAGCC
>probe:Drosophila_2:1636939_at:445:547; Interrogation_Position=2421; Antisense; GGATGTCAGCCTTTGCCAATCTTGC
>probe:Drosophila_2:1636939_at:637:315; Interrogation_Position=2457; Antisense; GCCTTTTGGCCTTTCAAGTGCAGAA
>probe:Drosophila_2:1636939_at:555:509; Interrogation_Position=2474; Antisense; GTGCAGAACTTCTTCCACGAGTTAC
>probe:Drosophila_2:1636939_at:512:543; Interrogation_Position=2531; Antisense; GGATATGTTCCCTCTAAGCGTGCAG
>probe:Drosophila_2:1636939_at:111:113; Interrogation_Position=2554; Antisense; AGCAGTCCTGGTCTTAGCTGAACTA
>probe:Drosophila_2:1636939_at:436:47; Interrogation_Position=2662; Antisense; ATCCTGTGATCCTCAAATGCGTCAG
>probe:Drosophila_2:1636939_at:540:115; Interrogation_Position=2685; Antisense; AGCATGCTGCAAACGGTCTGAAAAT
>probe:Drosophila_2:1636939_at:553:195; Interrogation_Position=2730; Antisense; AACTGATACAATCTGCCTTGGAGGA

Paste this into a BLAST search page for me
AGAGACGGCTCACTTAGACTACCGCAGACTACCGCCTCGTAGTGGGTGAAAAAGTCGCTCAGGAGTTGGGTCCTCTGGGTCCTCTTTGCTTTCGATACAAGATACAAGGCTGTTCTTCTCAACTGTGTTCACGAATTCCGGATGTCAGCCGGATGTCAGCCTTTGCCAATCTTGCGCCTTTTGGCCTTTCAAGTGCAGAAGTGCAGAACTTCTTCCACGAGTTACGGATATGTTCCCTCTAAGCGTGCAGAGCAGTCCTGGTCTTAGCTGAACTAATCCTGTGATCCTCAAATGCGTCAGAGCATGCTGCAAACGGTCTGAAAATAACTGATACAATCTGCCTTGGAGGA

Full Affymetrix probeset data:

Annotations for 1636939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime